IthaID: 2287



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: -126 (-TTT) HGVS Name: NT_010393.16:g.31479059delTTT

Context nucleotide sequence:
CCCTGGTTTGGCTCTTGCCTTCTTGCATTTCCTGGGTTTCCTCATTTATC [TTT/-] TTTTTTTTTTTTTTTGGCCTTGTTATCTTTCTACCTTCAGGGAAGCCTCT (Strand: +)

Also known as: 12020(T15>T18), c.-126TdelTTT, rs5816533

Comments: T-homopolymer in the putative promoter of the AHSP gene. Reporter gene assays showed that the shorter T15 allele associated with lower activity compared to the longer T18 allele, indicating that the T-homopolymer affects AHSP promoter activity. Also, the T15 allele associated with reduced AHSP mRNA in reticulocytes [PMID: 16704446]. Modulating factor of β-thalassaemia disease phenotype.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):Decreased expression for AHSP
Allele Phenotype (Trans):N/A
Associated Phenotypes: Anaemia [HP:0001903]

Location

Chromosome: 16
Locus: NT_010393.16
Locus Location: 31479059
Size: 3 bp
Located at: AHSP
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Afro-Caribbean, Indian, Brasilian, Mediterranean, Papua New Guinean, Melanesian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Lai MI, Jiang J, Silver N, Best S, Menzel S, Mijovic A, Colella S, Ragoussis J, Garner C, Weiss MJ, Thein SL, Alpha-haemoglobin stabilising protein is a quantitative trait gene that modifies the phenotype of beta-thalassaemia., Br. J. Haematol. , 133(6), 675-82, 2006 PubMed
  2. dos Santos CO, Zhou S, Secolin R, Wang X, Cunha AF, Higgs DR, Kwiatkowski JL, Thein SL, Gallagher PG, Costa FF, Weiss MJ, Population analysis of the alpha hemoglobin stabilizing protein (AHSP) gene identifies sequence variants that alter expression and function., Am. J. Hematol. , 83(2), 103-8, 2008 PubMed
Created on 2013-10-16 16:18:14, Last reviewed on 2019-07-04 12:01:01 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.