IthaID: 2286



Names and Sequences

Functionality: Neutral polymorphism Pathogenicity: N/A
Common Name: -473 (A>G) HGVS Name: NT_010393.16:g.31478982A>G

Context nucleotide sequence:
TAGGGCTCAGTAAACGTCAATTTCCATAGCATTTCGAGCCTGGATACTGA [A/G] ATATGGGGCAAAAAGCAGGAACATGCCCCTGGTTTGGCTCTTGCCTTCTTGCATTTCCTG (Strand: +)

Also known as: 11943(A>G), c.-201A, rs4499252

Comments: Apparently neutral polymorphism in the promoter region of AHSP (alpha-haemoglobin stabilizing protein)

External Links

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NT_010393.16
Locus Location: 31478982
Size: 1 bp
Located at: AHSP
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Afro-Caribbean, Indian, Brasilian, Mediterranean, Papua New Guinean, Melanesian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. dos Santos CO, Zhou S, Secolin R, Wang X, Cunha AF, Higgs DR, Kwiatkowski JL, Thein SL, Gallagher PG, Costa FF, Weiss MJ, Population analysis of the alpha hemoglobin stabilizing protein (AHSP) gene identifies sequence variants that alter expression and function., Am. J. Hematol. , 83(2), 103-8, 2008 PubMed
Created on 2013-10-16 15:59:50, Last reviewed on 2020-09-28 16:46:11 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.