IthaID: 2284



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 141 CTG>GGG HGVS Name: HBB:c.424C>G
Hb Name: Hb Aurillac Protein Info: β 141(H19) Leu>Val
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
AGTGGTGGCTGGTGTGGCTAATGCC [C/G] TGGCCCACAAGTATCACTAAGCTCG (Strand: -)

Comments: This variant has been previously described in a Japanese woman in combination with a second mutation in exon 3 of the same β-globin gene. The variant associating the two mutations was named Hb Kochi [β141(H19)Leu>Val (c.424C>G) ; 144>146(HC1)Lys-Tyr-His->0 (c.433A>T)]. In the double variant hemoglobin, the β141(H19) Leu>Val mutant was initially thought to have no contribution in the Hb affinity disorder, a conclusion which is not supported by the description of this variant.

External Links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: Increased Oxygen Affinity
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71998
Size: 1 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Caucasian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Boursier G, Trouillier S, Blaizot MG, Igual H, Schved JF, Martinez PA, A New High Affinity Variant Hb Aurillac (β141Leu→Val)., Hemoglobin , 2013 PubMed
Created on 2013-10-09 13:33:47, Last reviewed on 2013-10-15 17:00:14 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.