IthaID: 2274
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs10483801 | HGVS Name: | NG_011964.1:g.35428C>A |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AAGTGGGAATGCAGTTTGGCTAGTG [A/C] AAGTGGCAGATTTCCTCTGCCTTCA (Strand: +)
Comments: SNP associated with changes in HbF levels in sickle cell anaemia patients of African-American origin (MSH cohort) in response to hydroxyurea (HU) treatment [PMID: 17299377]. It also associated with elevated HbF levels in Hb S/β-thal patients after HU treatment and in non-transfusion-dependent β-thal (NTDT) patients of Hellenic (Greek) origin in two independent studies [PMID: 31039620]. In silico analysis showed that thia variant lies at a putative binding site for hsa-miR-3928-3p.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] Hb F response to hydroxyurea |
Location
Chromosome: | 14 |
---|---|
Locus: | NG_011964.1 |
Locus Location: | 35428 |
Size: | 1 bp |
Located at: | ARG2 |
Specific Location: | Intron 7 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American, Greek |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Ma Q, Wyszynski DF, Farrell JJ, Kutlar A, Farrer LA, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: genetic determinants of response to hydroxyurea., Pharmacogenomics J. , 7(6), 386-94, 2007 PubMed
- Green NS, Barral S, Emerging science of hydroxyurea therapy for pediatric sickle cell disease., Pediatr. Res. , 75(1), 196-204, 2014 PubMed
- Kolliopoulou A, Siamoglou S, John A, Sgourou A, Kourakli A, Symeonidis A, Vlachaki E, Chalkia P, Theodoridou S, Ali BR, Katsila T, Patrinos GP, Papachatzopoulou A, Role of Genomic Biomarkers in Increasing Fetal Hemoglobin Levels Upon Hydroxyurea Therapy and in β-Thalassemia Intermedia: A Validation Cohort Study., Hemoglobin, 2019 PubMed
Created on 2013-10-07 15:40:05,
Last reviewed on 2019-05-28 12:17:06 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.