IthaID: 225



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: IVS II-850 G>C HGVS Name: HBB:c.316-1G>C
Hb Name: N/A Protein Info: β nt 1345 G>C

Context nucleotide sequence:
TCATACCTCTTATCTTCCTCCCACA [A/C/G/T] CTCCTGGGCAACGTGCTGGTCTGTG (Strand: -)

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71889
Size: 1 bp
Located at: β
Specific Location: Intron 2

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Splice junction (mRNA Processing)
Ethnic Origin: Yugoslavian, Croatian
Inheritance: Recessive
DNA Sequence Determined: No
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Jankovic L, Dimovski AJ, Sukarova E, Juricic D, Efremov GD, A new mutation in the beta-globin gene (IVS II-850 G-C) found in a Yugoslavian beta-thalassemia heterozygote., Haematologica, 77(2), 119-21, 1992 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2014-04-08 14:44:49 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.