IthaID: 221



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: IVS II-848 (C>A) HGVS Name: HBB:c.316-3C>A
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GTTCATACCTCTTATCTTCCTCCCA [A/C/G] AGCTCCTGGGCAACGTGCTGGTCTG (Strand: -)

Also known as:

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71887
Size: 1 bp
Located at: β
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Consensus splice site (mRNA Processing)
Ethnic Origin: African-American, Egyptian, Iranian, Syrian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Gonzalez-Redondo JM, Stoming TA, Lanclos KD, Gu YC, Kutlar A, Kutlar F, Nakatsuji T, Deng B, Han IS, McKie VC, Clinical and genetic heterogeneity in black patients with homozygous beta-thalassemia from the southeastern United States., Blood, 72(3), 1007-14, 1988 PubMed
  2. Wong C, Antonarakis SE, Goff SC, Orkin SH, Forget BG, Nathan DG, Giardina PJ, Kazazian HH, Beta-thalassemia due to two novel nucleotide substitutions in consensus acceptor splice sequences of the beta-globin gene., Blood, 73(4), 914-8, 1989 PubMed
  3. Shoujaa A, Mukhalalaty Y, Murad H, Al-Quobaili F, Description of a rare β-globin gene mutation, IVS-II-848 (C>A) (: c.316-3C>A) in association with IVS-I-1 (G>A) (: c.92 + 1G>A), observed in a Syrian family: a case report., Hemoglobin, 43(0), 283-285, 2019 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2020-01-31 09:36:12 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.