IthaID: 2183

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Variant of Uncertain Significance
Common Name:	IVS II-781 C>G	HGVS Name:	HBB:c.316-70C>G
Hb Name:	N/A	Protein Info:	β nt 1276 C>G

Context nucleotide sequence:
CTTTTATTTTATGGTTGGGATAAGG [C/G] TGGATTATTCTGAGTCCAAGCTAGG (Strand: -)

Also known as:

Comments: In the first report described as a β+ variant in a case with heterozygosity with the Hb A2’, HBD:c.49G>C [IthaID:1356], presented with elevated HbA2 4.4% but normal haematological indices. Furthermore, found in coinheritance with other α-, β- or δ-globin gene defects, shown no influence or change of this sequence variant on the expected hematological and clinical indices as simple carrier. The HBB:c.316-70C>G, was associated with Hb A2’ in most cases, suggesting that these two mutations are in linkage.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

HbVar	dbSNP
LOVD	ClinVar

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	β-thalassaemia
Allele Phenotype:	Unclear
Associated Phenotypes:	Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	71820
Size:	1 bp
Located at:	β
Specific Location:	Intron 2

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	African
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Henderson SJ, Timbs AT, McCarthy J, Gallienne AE, Proven M, Rugless MJ, Lopez H, Eglinton J, Dziedzic D, Beardsall M, Khalil MS, Old JM, Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations., Hemoglobin , 40(2), 75-84, 2016 PubMed
Vinciguerra M, Passarello C, Leto F, Crivello A, Fustaneo M, Cassarà F, Cannata M, Maggio A, Giambona A, Coinheritance of a Rare Nucleotide Substitution on the β-Globin Gene and Other Known Mutations in the Globin Clusters: Management in Genetic Counseling., Hemoglobin, 40(4), 231-5, 2016 PubMed
Grimholt RM, Harteveld CL, Arkesteijn SGJ, Fjeld B, Klingenberg O, Characterization of Two Deep Intronic Variants on the β-Globin Gene with Inconsistent Interpretations of Clinical Significance., Hemoglobin, 42(2), 126-128, 2018 PubMed

Created on 2013-09-30 16:20:59, Last reviewed on 2022-02-17 21:40:35 (Show full history)

A/A	Date	Curator(s)	Comments
1	2013-09-30 16:20:59	The IthaGenes Curation Team	Created
2	2013-10-15 17:00:14	The IthaGenes Curation Team	Reviewed.
3	2014-04-17 09:48:42	The IthaGenes Curation Team	Reviewed. Added context sequence and corrected HGVS name.
4	2016-08-31 17:50:32	The IthaGenes Curation Team	Reviewed. Update of comment section. β+ phenotype checked. Confirmed by sequencing. Reference added.
5	2022-02-15 13:50:40	The IthaGenes Curation Team	Reviewed.
6	2022-02-15 14:01:02	The IthaGenes Curation Team	Reviewed. Reference added.
7	2022-02-17 21:36:01	The IthaGenes Curation Team	Reviewed. Comment added.
8	2022-02-17 21:37:43	The IthaGenes Curation Team	Reviewed. Chromosome location corrected.
9	2022-02-17 21:40:35	The IthaGenes Curation Team	Reviewed.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.