IthaID: 2181
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 72/73 (+T) | HGVS Name: | HBB:c.219dupT |
Hb Name: | N/A | Protein Info: | β 73(+T); modified C-terminal sequence: (73)stop codon |
Context nucleotide sequence:
CAAGAAAGTGCTCGGTGCCTTTAGT [-/T] GATGGCCTGGCTCACCTGGACAACC (Strand: -)
Also known as:
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70943 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Exon 2 |
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β0 |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Other details
Type of Mutation: | Point-Mutation(Insertion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | British |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Henderson SJ, Timbs AT, McCarthy J, Gallienne AE, Proven M, Rugless MJ, Lopez H, Eglinton J, Dziedzic D, Beardsall M, Khalil MS, Old JM, Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations., Hemoglobin , 40(2), 75-84, 2016 PubMed
Created on 2013-09-30 16:12:01,
Last reviewed on 2019-11-13 13:45:07 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2013-09-30 16:12:01 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:00:14 | The IthaGenes Curation Team | Reviewed. |
3 | 2014-04-17 09:44:10 | The IthaGenes Curation Team | Reviewed. Added context sequence and corrected HGVS name. |
4 | 2016-08-31 17:01:11 | The IthaGenes Curation Team | Reviewed. Reference added. Confirmed by sequencing. |
5 | 2019-11-13 13:45:07 | The IthaGenes Curation Team | Reviewed. HGVS name corrected. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2021-01-22 12:22:59