IthaID: 2141

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	rs12155519	HGVS Name:	NG_011993.1:g.187938C>T

Context nucleotide sequence:
TTCCTCTTGGTTTATCCAAATCAAA [A/G] CCCTCCTTCAAGCCGTGACGGCTGT (Strand: +)

Also known as:

Comments: SNP associated with HbF levels in the older subjects (≥24 years; n=538) of the Cooperative Study of Sickle Cell Disease (CSSCD). The association was replicated in an independent sample of sickle cell patients (n=211) acquired from the Multicenter Study of Hydroxyurea in Sickle Cell Anemia (MSH). SNP associated with the HbF response to treatment with hydroxyurea in individuals with sickle cell disease (n=137) acquired from the MSH study.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	N/A
Associated Phenotypes:	Hb F levels [HP:0011904] [OMIM:141749] Hb F response to hydroxyurea

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	8
Locus:	NG_011993.1
Locus Location:	187938
Size:	1 bp
Located at:	TOX
Specific Location:	Intron 3

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	African Americans
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Ma Q, Wyszynski DF, Farrell JJ, Kutlar A, Farrer LA, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: genetic determinants of response to hydroxyurea., Pharmacogenomics J. , 7(6), 386-94, 2007 PubMed
Sebastiani P, Wang L, Nolan VG, Melista E, Ma Q, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: Bayesian modeling of genetic associations., Am. J. Hematol. , 83(3), 189-95, 2008 PubMed

Created on 2013-09-27 11:38:53, Last reviewed on 2016-05-12 10:34:23 (Show full history)

A/A	Date	Curator(s)	Comments
1	2013-09-27 11:38:53	The IthaGenes Curation Team	Created
2	2013-10-15 17:00:14	The IthaGenes Curation Team	Reviewed.
3	2016-05-12 10:34:23	The IthaGenes Curation Team	Reviewed.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.