IthaID: 2138
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | IVS X-1549 A>G | HGVS Name: | NG_011994.1:g.333995G>A |
Context nucleotide sequence:
GGCATCTCAGATCCAGACCAGTGTGA [A/G] GCAAGTCAAGAAGGCCCTAATTTAG (Strand: +)
Also known as: rs487278
Comments: Associated with the HbF response to hydroxyurea (HU) in SCD patients
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Hb F response to hydroxyurea |
Location
Chromosome: | 6 |
---|---|
Locus: | NG_011994.1 |
Locus Location: | 333995 |
Size: | 1 bp |
Located at: | PDE7B |
Specific Location: | N/A |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African Americans |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | No |
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Ma Q, Wyszynski DF, Farrell JJ, Kutlar A, Farrer LA, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: genetic determinants of response to hydroxyurea., Pharmacogenomics J. , 7(6), 386-94, 2007 PubMed
Created on 2013-09-27 09:57:39,
Last reviewed on 2013-10-15 17:00:14 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2013-09-27 09:57:39 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:00:14 | The IthaGenes Curation Team | Reviewed. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2022-06-24 13:54:27