IthaID: 2130



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs2237863 HGVS Name: NG_023386.1:g.19251T>C

Context nucleotide sequence:
CAGAGGGCCGGTGCTGGGGTCCAGA [C/T] GGTGTCAACAGGGATGGTCCCTGTC (Strand: +)

Comments: SNP associated with susceptibility to alloimmunization in individuals with sickle cell disease receiving red blood cell transfusions (n=75).

External Links

Location

Chromosome: 11
Locus: NG_023386.1
Locus Location: 19251
Size: 1 bp
Located at: CD81
Specific Location: Intron 2

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Red blood cell alloimmunisation

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Sub-Saharan African
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Tatari-Calderone Z, Tamouza R, Le Bouder GP, Dewan R, Luban NL, Lasserre J, Maury J, Lionnet F, Krishnamoorthy R, Girot R, Vukmanovic S, The association of CD81 polymorphisms with alloimmunization in sickle cell disease., Clin. Dev. Immunol. , 2013(65535), 937846, 2013 PubMed
Created on 2013-09-24 13:18:09, Last reviewed on 2016-09-12 12:50:18 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.