IthaID: 213



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: IVS II-726 A>G HGVS Name: HBB:c.316-125A>G
Hb Name: N/A Protein Info: β nt 1221 A>G

Context nucleotide sequence:
CTGATGTAAGAGGTTTCATATTGCT [A/G] ATAGCAGCTACAATCCAGCTACCAT (Strand: -)

Also known as:

Comments: Found in a homozygous state in an 8-year-old Moroccan male with beta-thalassaemia intermedia. Mother was heterozygous for this variant with blood profiles consistent with β-thalassaemia trait [PMID: 17994377]. Detected as a heterozygote (normal or borderline red cell indices) and in association with β0 IVS I-1 G>A ( heterozygous trait phenotype) in the resident Sicilian population [PMID: 29171316]. Detected as a heterozygote in five individuals with normal hematology and in association with Hb D-Punjab without a thalassaemia phenotype [PMID: 30047296]. Reported as a mild β+ allele.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71765
Size: 1 bp
Located at: β
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Moroccan, Italian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Agouti I, Bennani M, Ahmed A, Barakat A, Mohamed K, Badens C, Thalassemia intermedia due to a novel mutation in the second intervening sequence of the beta-globin gene., Hemoglobin, 31(4), 433-8, 2007 PubMed
  2. Vinciguerra M, Cannata M, Cassarà F, Passarello C, Leto F, Calvaruso G, Renda D, Maggio A, Giambona A, HBB: c.316-125A>G and HBB: c.316-42delC: Phenotypic Evaluations of Two Rare Changes in the Second Intron of the HBB Gene., Hemoglobin, 41(0), 234-238, 2017 PubMed
  3. Grimholt RM, Harteveld CL, Arkesteijn SGJ, Fjeld B, Klingenberg O, Characterization of Two Deep Intronic Variants on the β-Globin Gene with Inconsistent Interpretations of Clinical Significance., Hemoglobin, 42(2), 126-128, 2018 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2023-02-23 11:32:14 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.