IthaID: 2127



Names and Sequences

Functionality: Disease modifying mutation
Common Name: -158 C>T HGVS Name: NG_000007.3:g.42677C>T

Context nucleotide sequence:
CAACCCATGGGTGGAGTTTAGCCAGG [C/T] ACCGTTTCAGACAGATATTTGCATT (Strand: -)

Also known as: XmnI

Comments: Xmn1-Gγ site is common in all population groups and is present at a frequency of 0.32–0.35. Xmn1-Gγ does not always raise the Hb F levels in otherwise normal individuals. Under conditions of haemopoietic stress, for example in homozygous β-thalassaemia and sickle cell disease, presence of the Xmn1-Gγ site favour a higher Hb F response. The presence of the XmnI T/T genotype correlates strongly in response to hydroxyurea treatment in transfusion-dependent β-thal patients.

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 42677
Size: 1 bp
Located at:
Specific Location: Promoter

Phenotype

Allele Phenotype (Cis):Increased expression for Gγ
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]
Hb F response to hydroxyurea

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes
Detection Methods: RED, Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Labie D, Pagnier J, Lapoumeroulie C, Rouabhi F, Dunda-Belkhodja O, Chardin P, Beldjord C, Wajcman H, Fabry ME, Nagel RL, Common haplotype dependency of high G gamma-globin gene expression and high Hb F levels in beta-thalassemia and sickle cell anemia patients., Proc. Natl. Acad. Sci. U.S.A. , 82(7), 2111-4, 1985 PubMed
  2. Gilman JG, Huisman TH, DNA sequence variation associated with elevated fetal G gamma globin production., Blood , 66(4), 783-7, 1985 PubMed
  3. Sampietro M, Thein SL, Contreras M, Pazmany L, Variation of HbF and F-cell number with the G-gamma Xmn I (C-T) polymorphism in normal individuals., Blood , 79(3), 832-3, 1992 PubMed
  4. Yavarian M, Karimi M, Bakker E, Harteveld CL, Giordano PC, Response to hydroxyurea treatment in Iranian transfusion-dependent beta-thalassemia patients., Haematologica, 89(10), 1172-8, 2004 PubMed
  5. Thein SL, Genetic insights into the clinical diversity of beta thalassaemia., Br. J. Haematol. , 124(3), 264-74, 2004 PubMed
  6. Alebouyeh M, Moussavi F, Haddad-Deylami H, Vossough P, Hydroxyurea in the treatment of major beta-thalassemia and importance of genetic screening., Ann. Hematol. , 83(7), 430-3, 2004 PubMed
  7. Bradai M, Pissard S, Abad MT, Dechartres A, Ribeil JA, Landais P, de Montalembert M, Decreased transfusion needs associated with hydroxyurea therapy in Algerian patients with thalassemia major or intermedia., Transfusion , 47(10), 1830-6, 2007 PubMed
  8. Koren A, Levin C, Dgany O, Kransnov T, Elhasid R, Zalman L, Palmor H, Tamary H, Response to hydroxyurea therapy in beta-thalassemia., Am. J. Hematol. , 83(5), 366-70, 2008 PubMed
  9. Italia KY, Jijina FJ, Merchant R, Panjwani S, Nadkarni AH, Sawant PM, Nair SB, Ghosh K, Colah RB, Response to hydroxyurea in beta thalassemia major and intermedia: experience in western India., Clin. Chim. Acta , 407(1), 10-5, 2009 PubMed
  10. Banan M, Bayat H, Azarkeivan A, Mohammadparast S, Kamali K, Farashi S, Bayat N, Khani MH, Neishabury M, Najmabadi H, The XmnI and BCL11A single nucleotide polymorphisms may help predict hydroxyurea response in Iranian β-thalassemia patients., Hemoglobin , 36(4), 371-80, 2012 PubMed
Created on 2013-09-24 12:25:07, Last reviewed on 2016-10-25 11:28:40 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.