IthaID: 2120



Names and Sequences

Functionality: Disease modifying mutation
Common Name: -495 (A>T) HGVS Name: NG_023030.1:g.4613A>T

Context nucleotide sequence:
AAGTTCCTGATGTTGCCCACCAGGCT [A/T] TTGCTCTGAGCAGCGCTGCCTCCCA

Also known as: rs2071746

Comments: Association between the TT genotype of the polymorphism and increased levels of Hb F in sickle cell anemia patients from Brazil

External Links

Location

Chromosome: 22
Locus: NG_023030.1
Locus Location: 4613
Size: 1 bp
Located at: HMOX1
Specific Location: Promoter 0

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Brazilians
Inheritance: Quantitative trait
DNA Sequence Determined: No
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Gil GP, Ananina G, Oliveira MB, Costa FF, Silva MJ, Santos MN, Bezerra MA, Hatzlhofer BL, Araujo AS, Melo MB, Polymorphism in the HMOX1 gene is associated with high levels of fetal hemoglobin in Brazilian patients with sickle cell anemia., Hemoglobin , 37(4), 315-24, 2013 PubMed
Created on 2013-09-19 13:19:31, Last reviewed on 2013-10-15 17:00:14 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.