IthaID: 2114



Names and Sequences

Functionality: Disease modifying mutation
Common Name: IVS XII-9251 G>A HGVS Name: NG_007563.1:g.115072G>A

Context nucleotide sequence:
TACCAATGTATTGTTCTGTTTAAAAT [A/G] TGGAAACCTGAGGAAATGAACAAAG (Strand: +)

Also known as: rs12559632

Comments: Moderately strong association with F-cell levels

External Links

Location

Chromosome: X
Locus: NG_007563.1
Locus Location: 115072
Size: 1 bp
Located at: PHEX
Specific Location: N/A 0

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):Increased expression for Aγ or Gγ
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Africans
Inheritance: Quantitative trait
DNA Sequence Determined: No
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Bhatnagar P, Purvis S, Barron-Casella E, DeBaun MR, Casella JF, Arking DE, Keefer JR, Genome-wide association study identifies genetic variants influencing F-cell levels in sickle-cell patients., J. Hum. Genet. , 56(4), 316-23, 2011 PubMed
Created on 2013-09-18 16:37:53, Last reviewed on 2013-10-15 17:00:14 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.