IthaID: 210



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: IVS II-613 (C>T) HGVS Name: HBB:c.316-238C>T
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
TACAATGTATCATGCCTCTTTG [C/T] ACCATTCTAAAGAATAACAGTG (Strand: -)

Also known as:

Comments: Additional cases reported with Indian and Malay origin.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:Unclear
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71652
Size: 1 bp
Located at: β
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Indian, Malay
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Nadkarni A, Gorakshakar A, Surve R, Sawant P, Phanasgaonkar S, Nair S, Ghosh K, Colah RB, Hematological and molecular analysis of novel and rare beta-thalassemia mutations in the Indian population., Hemoglobin, 33(1), 59-65, 2009 PubMed

Microattributions

A/AContributor(s)DateComments
1Mohd Yasin, Norafiza 2020-10-20Report of an update.
Created on 2010-06-16 16:13:15, Last reviewed on 2021-10-20 14:56:11 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.