IthaID: 2097



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs7775698 HGVS Name: NC_000006.12:g.135097497C>T

Context nucleotide sequence:
AATTCACTCTGGACAGCAGATGTTA [C/T] TATATCAAAACCACAAAATGTTATC (Strand: +)

Comments: SNP is located within the -84 LDB1 complex/KLF1-binding site in the immediate vicinity of a TAL1 and GATA1 motif. The minor allele T tags a 3-bp deletion (rs66650371 [IthaID: 2840]), which is probably the most significant functional variant within HMIP accounting for the variation of HbF levels among diverse populations. rs7775698 (T) tags the 3-bp deletion in the Chinese and European populations, but rarely so in African populations [PMID: 24614105]. SNP was associated with elevated HbF levels in a Chinese cohort with β-thalassaemia trait [PMID: 21385855], as well as with disease severity and HbF levels in Thai β0-thalassaemia/HbE patients [PMID: 20183929]. SNP associated with a lower red blood cell count in the Korean Genome Epidemiology Study (KoGES; n=8842), as well as in healthy samples from the Cardio Vascular Disease Association Study (CAVAS) of KoGES (n=3667) [PMID: 26064965].

External Links

Location

Chromosome: 6
Locus: NT_025741.15
Locus Location: N/A
Size: 1 bp
Located at: HBS1L-MYB
Specific Location: N/A 0

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]
Abnormal red blood cell count [HP:0020058]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Chinese, European, African, Thai, Korean
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Nuinoon M, Makarasara W, Mushiroda T, Setianingsih I, Wahidiyat PA, Sripichai O, Kumasaka N, Takahashi A, Svasti S, Munkongdee T, Mahasirimongkol S, Peerapittayamongkol C, Viprakasit V, Kamatani N, Winichagoon P, Kubo M, Nakamura Y, Fucharoen S, A genome-wide association identified the common genetic variants influence disease severity in beta0-thalassemia/hemoglobin E., Hum. Genet. , 127(3), 303-14, 2010 PubMed
  2. Farrell JJ, Sherva RM, Chen ZY, Luo HY, Chu BF, Ha SY, Li CK, Lee AC, Li RC, Li CK, Yuen HL, So JC, Ma ES, Chan LC, Chan V, Sebastiani P, Farrer LA, Baldwin CT, Steinberg MH, Chui DH, A 3-bp deletion in the HBS1L-MYB intergenic region on chromosome 6q23 is associated with HbF expression., Blood , 117(18), 4935-45, 2011 PubMed
  3. Stadhouders R, Aktuna S, Thongjuea S, Aghajanirefah A, Pourfarzad F, van Ijcken W, Lenhard B, Rooks H, Best S, Menzel S, Grosveld F, Thein SL, Soler E, HBS1L-MYB intergenic variants modulate fetal hemoglobin via long-range MYB enhancers., J. Clin. Invest. , 124(4), 1699-710, 2014 PubMed
  4. Kim YK, Oh JH, Kim YJ, Hwang MY, Moon S, Low SK, Takahashi A, Matsuda K, Kubo M, Lee J, Kim BJ, Influence of Genetic Variants in EGF and Other Genes on Hematological Traits in Korean Populations by a Genome-Wide Approach., Biomed Res Int , 2015(0), 914965, 2015 PubMed
Created on 2013-09-13 10:18:14, Last reviewed on 2019-11-18 15:49:44 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.