IthaID: 2097

Context nucleotide sequence:
AATTCACTCTGGACAGCAGATGTTA [C/T] TATATCAAAACCACAAAATGTTATC (Strand: +)

Also known as:

Comments: SNP is located within the -84 LDB1 complex/KLF1-binding site in the immediate vicinity of a TAL1 and GATA1 motif. The minor allele T tags a 3-bp deletion (rs66650371 [IthaID: 2840]), which is probably the most significant functional variant within HMIP accounting for the variation of HbF levels among diverse populations. rs7775698 (T) tags the 3-bp deletion in the Chinese and European populations, but rarely so in African populations [PMID: 24614105]. SNP was associated with elevated HbF levels in a Chinese cohort with β-thalassaemia trait [PMID: 21385855], as well as with disease severity and HbF levels in Thai β0-thalassaemia/HbE patients [PMID: 20183929]. SNP associated with a lower red blood cell count in the Kore Association Resource (KARE) project of the Korean Genome Epidemiology Study (KoGES; n=8842). The association was replicated in healthy samples from the Cardio Vascular Disease Association Study (CAVAS) of KoGES (n=3667) [PMID: 26064965].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Heterozygous records (preview in IthaPhen)

1. Nuinoon M, Makarasara W, Mushiroda T, Setianingsih I, Wahidiyat PA, Sripichai O, Kumasaka N, Takahashi A, Svasti S, Munkongdee T, Mahasirimongkol S, Peerapittayamongkol C, Viprakasit V, Kamatani N, Winichagoon P, Kubo M, Nakamura Y, Fucharoen S, A genome-wide association identified the common genetic variants influence disease severity in beta0-thalassemia/hemoglobin E., Hum. Genet. , 127(3), 303-14, 2010 PubMed
2. Farrell JJ, Sherva RM, Chen ZY, Luo HY, Chu BF, Ha SY, Li CK, Lee AC, Li RC, Li CK, Yuen HL, So JC, Ma ES, Chan LC, Chan V, Sebastiani P, Farrer LA, Baldwin CT, Steinberg MH, Chui DH, A 3-bp deletion in the HBS1L-MYB intergenic region on chromosome 6q23 is associated with HbF expression., Blood , 117(18), 4935-45, 2011 PubMed
3. Stadhouders R, Aktuna S, Thongjuea S, Aghajanirefah A, Pourfarzad F, van Ijcken W, Lenhard B, Rooks H, Best S, Menzel S, Grosveld F, Thein SL, Soler E, HBS1L-MYB intergenic variants modulate fetal hemoglobin via long-range MYB enhancers., J. Clin. Invest. , 124(4), 1699-710, 2014 PubMed
4. Kim YK, Oh JH, Kim YJ, Hwang MY, Moon S, Low SK, Takahashi A, Matsuda K, Kubo M, Lee J, Kim BJ, Influence of Genetic Variants in EGF and Other Genes on Hematological Traits in Korean Populations by a Genome-Wide Approach., Biomed Res Int , 2015(0), 914965, 2015 PubMed