IthaID: 2096



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs9399137 HGVS Name: NC_000006.12:g.135097880T>C

Context nucleotide sequence:
GTAATTAACTGAACATATGGTTATT [C/T] ACAGTTTTTTCACAAGCAACCCTGC (Strand: +)

Also known as:

Comments: Associated with variation in HbF levels and F-cell numbers in healthy Northern Europeans (TwinsUK cohort). It strongly associated with HbF levels in the African American Cooperative Study of Sickle Cell Disease (CSSCD), in sickle cell disease (SCD) cohorts from Brazil, Cameroon and Tanzania, and in individuals from Thailand and China with β-thalassaemia and/or Hb E trait. Associated with increased HbF levels as well as clinical outcomes (acute chest syndrome and infection risk) and haematological parameters (total Hb levels and reticulocyte count) in pediatric patients with SCA from southeastern Brazil (n=240). Associated with HbF levels in Portuguese β-thal carriers. Associated with HbF levels in individuals from the SardiNIA study. It exhibited strong effect on the severity of the β-thalassaemia phenotype in Sardinian subjects. Associated with disease severity in Thai β0-thalassaemia/HbE patients. Associated with HbF levels in β-thalassaemia patients from Guangxi, Southern China. Associated with platelet and red blood cell counts in a Northern European cohort of healthy individuals. It significantly associated with fewer pain event in young patients with SCA (BABY HUG cohort) [PMID: 23606168]. Associated with a higher platelet count in the Kore Association Resource (KARE) project of the Korean Genome Epidemiology Study (KoGES; n=8842). The association was replicated in healthy samples from the Cardio Vascular Disease Association Study (CAVAS) of KoGES (n=3667) [PMID: 26064965]. The C allele associated with HbF in Kuwaiti patients with sickle cell disease. Found in almost complete LD with rs66650371 (3bp deletion) and rs35786788, conveying a strong association with high-HbF levels (>30%) [PMID: 34204365].

External Links

Location

Chromosome: 6
Locus: NT_025741.15
Locus Location: N/A
Size: 1 bp
Located at: HBS1L-MYB
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: North European, African American, Cameroonian, Brazilian, Sardinians, Thai, Thai-Chinese, Chinese (Hong Kong), French, African, Tanzanian, Thai, Portuguese, Chinese, Korean, Kuwaiti
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Lanson Y, Reignoux J, Jobard P, Vandooren M, Rouleau P, Soret JY, [Osteogenic sarcoma of the kidney. Apropos of a case. Review of the literature]., J Urol Nephrol (Paris) , 84(10), 827-34, 1978 PubMed
  2. Menzel S, Garner C, Gut I, Matsuda F, Yamaguchi M, Heath S, Foglio M, Zelenika D, Boland A, Rooks H, Best S, Spector TD, Farrall M, Lathrop M, Thein SL, A QTL influencing F cell production maps to a gene encoding a zinc-finger protein on chromosome 2p15., Nat. Genet. , 39(10), 1197-9, 2007 PubMed
  3. Menzel S, Jiang J, Silver N, Gallagher J, Cunningham J, Surdulescu G, Lathrop M, Farrall M, Spector TD, Thein SL, The HBS1L-MYB intergenic region on chromosome 6q23.3 influences erythrocyte, platelet, and monocyte counts in humans., Blood , 110(10), 3624-6, 2007 PubMed
  4. Thein SL, Menzel S, Peng X, Best S, Jiang J, Close J, Silver N, Gerovasilli A, Ping C, Yamaguchi M, Wahlberg K, Ulug P, Spector TD, Garner C, Matsuda F, Farrall M, Lathrop M, Intergenic variants of HBS1L-MYB are responsible for a major quantitative trait locus on chromosome 6q23 influencing fetal hemoglobin levels in adults., Proc. Natl. Acad. Sci. U.S.A. , 104(27), 11346-51, 2007 PubMed
  5. Lettre G, Sankaran VG, Bezerra MA, Araújo AS, Uda M, Sanna S, Cao A, Schlessinger D, Costa FF, Hirschhorn JN, Orkin SH, DNA polymorphisms at the BCL11A, HBS1L-MYB, and beta-globin loci associate with fetal hemoglobin levels and pain crises in sickle cell disease., Proc. Natl. Acad. Sci. U.S.A. , 105(33), 11869-74, 2008 PubMed
  6. Solovieff N, Milton JN, Hartley SW, Sherva R, Sebastiani P, Dworkis DA, Klings ES, Farrer LA, Garrett ME, Ashley-Koch A, Telen MJ, Fucharoen S, Ha SY, Li CK, Chui DH, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: genome-wide association studies suggest a regulatory region in the 5' olfactory receptor gene cluster., Blood , 115(9), 1815-22, 2010 PubMed
  7. Nuinoon M, Makarasara W, Mushiroda T, Setianingsih I, Wahidiyat PA, Sripichai O, Kumasaka N, Takahashi A, Svasti S, Munkongdee T, Mahasirimongkol S, Peerapittayamongkol C, Viprakasit V, Kamatani N, Winichagoon P, Kubo M, Nakamura Y, Fucharoen S, A genome-wide association identified the common genetic variants influence disease severity in beta0-thalassemia/hemoglobin E., Hum. Genet. , 127(3), 303-14, 2010 PubMed
  8. Bhatnagar P, Purvis S, Barron-Casella E, DeBaun MR, Casella JF, Arking DE, Keefer JR, Genome-wide association study identifies genetic variants influencing F-cell levels in sickle-cell patients., J. Hum. Genet. , 56(4), 316-23, 2011 PubMed
  9. Badens C, Joly P, Agouti I, Thuret I, Gonnet K, Fattoum S, Francina A, Simeoni MC, Loundou A, Pissard S, Variants in genetic modifiers of β-thalassemia can help to predict the major or intermedia type of the disease., Haematologica , 96(11), 1712-4, 2011 PubMed
  10. Farrell JJ, Sherva RM, Chen ZY, Luo HY, Chu BF, Ha SY, Li CK, Lee AC, Li RC, Li CK, Yuen HL, So JC, Ma ES, Chan LC, Chan V, Sebastiani P, Farrer LA, Baldwin CT, Steinberg MH, Chui DH, A 3-bp deletion in the HBS1L-MYB intergenic region on chromosome 6q23 is associated with HbF expression., Blood , 117(18), 4935-45, 2011 PubMed
  11. Danjou F, Anni F, Perseu L, Satta S, Dessì C, Lai ME, Fortina P, Devoto M, Galanello R, Genetic modifiers of β-thalassemia and clinical severity as assessed by age at first transfusion., Haematologica , 97(7), 989-93, 2012 PubMed
  12. Sheehan VA, Luo Z, Flanagan JM, Howard TA, Thompson BW, Wang WC, Kutlar A, Ware RE, , Genetic modifiers of sickle cell anemia in the BABY HUG cohort: influence on laboratory and clinical phenotypes., Am. J. Hematol. , 88(7), 571-6, 2013 PubMed
  13. Wonkam A, Ngo Bitoungui VJ, Vorster AA, Ramesar R, Cooper RS, Tayo B, Lettre G, Ngogang J, Association of variants at BCL11A and HBS1L-MYB with hemoglobin F and hospitalization rates among sickle cell patients in Cameroon., PLoS ONE , 9(3), e92506, 2014 PubMed
  14. Pakdee N, Yamsri S, Fucharoen G, Sanchaisuriya K, Pissard S, Fucharoen S, Variability of hemoglobin F expression in hemoglobin EE disease: hematological and molecular analysis., Blood Cells Mol. Dis. , 53(1), 11-5, 2014 PubMed
  15. Mtatiro SN, Mgaya J, Singh T, Mariki H, Rooks H, Soka D, Mmbando B, Thein SL, Barrett JC, Makani J, Cox SE, Menzel S, Genetic association of fetal-hemoglobin levels in individuals with sickle cell disease in Tanzania maps to conserved regulatory elements within the MYB core enhancer., BMC Med. Genet. , 16(0), 4, 2015 PubMed
  16. Pereira C, Relvas L, Bento C, Abade A, Ribeiro ML, Manco L, Polymorphic variations influencing fetal hemoglobin levels: association study in beta-thalassemia carriers and in normal individuals of Portuguese origin., Blood Cells Mol. Dis. , 54(4), 315-20, 2015 PubMed
  17. Danjou F, Zoledziewska M, Sidore C, Steri M, Busonero F, Maschio A, Mulas A, Perseu L, Barella S, Porcu E, Pistis G, Pitzalis M, Pala M, Menzel S, Metrustry S, Spector TD, Leoni L, Angius A, Uda M, Moi P, Thein SL, Galanello R, Abecasis GR, Schlessinger D, Sanna S, Cucca F, Genome-wide association analyses based on whole-genome sequencing in Sardinia provide insights into regulation of hemoglobin levels., Nat. Genet. , 47(11), 1264-71, 2015 PubMed
  18. Yi S, Lai Y, Zuo Y, Chen Y, Qin H, Wei Y, Yang Q, Lin L, Luo J, Fan X, Zheng C, Common genetic polymorphisms at three loci affect HbF levels in β-thalassemia patients from Southern China., Blood Cells Mol. Dis. , 62(0), 22-23, 2016 PubMed
  19. Sales RR, Belisário AR, Faria G, Mendes F, Luizon MR, Viana MB, Functional polymorphisms of BCL11A and HBS1L-MYB genes affect both fetal hemoglobin level and clinical outcomes in a cohort of children with sickle cell anemia., Ann Hematol, 99(7), 1453-1463, 2020 PubMed
  20. Akbulut-Jeradi N, Fernandez MJ, Al Khaldi R, Sukumaran J, Adekile A, Unique Polymorphisms at , and Loci Associated with HbF in Kuwaiti Patients with Sickle Cell Disease., J Pers Med, 11(6), , 2021 PubMed
Created on 2013-09-12 17:04:01, Last reviewed on 2022-03-31 10:48:17 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.