IthaID: 209

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: IVS II-535 - CD 108 (+23, -310, +28) HGVS Name: HBB:c.[316-300_327delinsCAGGTGCCATCTGTCACCCTTTTCTTTG;316-316_316-315insAATATATTTTTAATATACTTTTT]
Hb Name: Hb Jambol Protein Info: β nts 1046 - 1357 deleted AND nts AATATATTTTTAATATACTTTTT inserted between nts 1030 and 1031 of β AND nts CAGGTGCCATCTGTCACCCTTTTCTTTG inserted between nts 1045 and 1358 of β

Context nucleotide sequence:

Also known as:


Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:Dominant
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]


Chromosome: 11
Locus: NG_000007.3
Locus Location: 71590
Size: 310 bp
Located at: β

Other details

Type of Mutation: Insertion & Deletion
Ethnic Origin: Bulgarian
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: No

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Efremov GD, Simjanovska L, Plaseska-Karanfilska D, Stanojevic E, Petkov GH, Hb Jambol: a new hyperunstable hemoglobin causing severe hemolytic anemia., Acta haematologica, 117(1), 1-7, 2007 PubMed
  2. Efremov GD, Dominantly Inherited beta-Thalassemia., Hemoglobin , 31(2), 193-207, 2007 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2013-10-15 17:00:14 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.