IthaID: 2088



Names and Sequences

Functionality: Disease modifying mutation
Common Name: CD 288 (AAG>TAG) HGVS Name: NG_013087.1:g.6836A>T

Context nucleotide sequence:
ACACGTGCGCGCACCCGGGTTGCGGC [A/T] AGAGCTACACCAAGAGCTCCCACCT (Strand: -)

Comments: Hereditary Persistence of Fetal Hemoglobin. Protein change:Lys288Ter

External Links

Location

Chromosome: 19
Locus: NG_013087.1
Locus Location: 6836
Size: 1 bp
Located at: KLF1
Specific Location: Exon 2

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):Increased expression for Aγ or Gγ
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Nonsense codon (Translation), Missense codons (Protein Structure)
Ethnic Origin: Maltese
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Borg J, Papadopoulos P, Georgitsi M, Gutiérrez L, Grech G, Fanis P, Phylactides M, Verkerk AJ, van der Spek PJ, Scerri CA, Cassar W, Galdies R, van Ijcken W, Ozgür Z, Gillemans N, Hou J, Bugeja M, Grosveld FG, von Lindern M, Felice AE, Patrinos GP, Philipsen S, Haploinsufficiency for the erythroid transcription factor KLF1 causes hereditary persistence of fetal hemoglobin., Nat. Genet. , 42(9), 801-5, 2010 PubMed
Created on 2013-06-28 13:16:03, Last reviewed on 2014-03-20 10:40:42 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.