IthaID: 2086

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	CD 334 (ACG>AGG)	HGVS Name:	NG_013087.1:g.7231C>G

Context nucleotide sequence:
GCTGACCCGCCACTACCGGAAACACA [C/G] GGGGCAGCGCCCCTTCCGCTGCCAG (Strand: -)

Also known as:

Comments: Protein change: T334R. Associated with increased production of HbF and with borderline HbA2 in the Chinese population. Identified in Thai subjects with Hb E disorder and high levels of HbF.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

ClinVar

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	Increased expression for Aγ or Gγ
Associated Phenotypes:	Hb F levels [HP:0011904] [OMIM:141749] Anaemia [HP:0001903]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	19
Locus:	NG_013087.1
Locus Location:	7231
Size:	1 bp
Located at:	KLF1
Specific Location:	Exon 3

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	Thai, Chinese
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Gallienne AE, Dréau HM, Schuh A, Old JM, Henderson S, Ten novel mutations in the erythroid transcription factor KLF1 gene associated with increased fetal hemoglobin levels in adults., Haematologica , 97(3), 340-3, 2012 PubMed
Lou JW, Li DZ, Zhang Y, He Y, Sun MN, Ye WL, Liu YH, Delineation of the molecular basis of borderline hemoglobin A2 in Chinese individuals., Blood Cells Mol. Dis. , 2014 PubMed
Liu D, Zhang X, Yu L, Cai R, Ma X, Zheng C, Zhou Y, Liu Q, Wei X, Lin L, Yan T, Huang J, Mohandas N, An X, Xu X, Erythroid Krüppel-like factor mutations are relatively more common in a thalassemia endemic region and ameliorate the clinical and hematological severity of β-thalassemia., Blood , 2014 PubMed
Tepakhan W, Yamsri S, Sanchaisuriya K, Fucharoen G, Xu X, Fucharoen S, Nine known and five novel mutations in the erythroid transcription factor KLF1 gene and phenotypic expression of fetal hemoglobin in hemoglobin E disorder., Blood Cells Mol. Dis. , 59(0), 85-91, 2016 PubMed

Created on 2013-06-28 13:13:38, Last reviewed on 2016-08-11 11:36:08 (Show full history)

A/A	Date	Curator(s)	Comments
1	2013-06-28 13:13:38	The IthaGenes Curation Team	Created
2	2013-10-15 17:00:14	The IthaGenes Curation Team	Reviewed.
3	2014-03-20 10:39:33	The IthaGenes Curation Team	Reviewed.
4	2014-04-24 08:59:44	The IthaGenes Curation Team	Reviewed. ClinVar link added.
5	2014-06-05 15:34:45	The IthaGenes Curation Team	Reviewed. Comments and references added.
6	2016-08-11 09:14:14	The IthaGenes Curation Team	Reviewed. Update of reference list.
7	2016-08-11 09:15:51	The IthaGenes Curation Team	Reviewed. Update of mutation characterization.
8	2016-08-11 11:36:08	The IthaGenes Curation Team	Reviewed.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.