IthaID: 2085



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: CD 175/176 (+7bp): (+CGGCGCC) HGVS Name: NG_013087.1:g.6493_6499dupCGGCGCC

Context nucleotide sequence:
ACCGGTGTACCCGGGGCCCGGCGCC [-/CGGCGCC] GGCTCCTCGGGTGGCTACTTCCCGC (Strand: -)

Also known as: c.519_525dupCGGCGCC, p.Gly176Argfs*179

Comments: Protein change: G176Rfs. Compound heterozygote with p.R301H and p.A298P. Abnormally low levels of the red cell enzyme pyruvate kinase, a known cause of CNSHA. Severe, transfusion dependent hemolytic anemia. Persistent expression of fetal hemoglobin and expression of large quantities of embryonic globins in post-natal life. Associated with increased production of HbF and with borderline HbA2. Co-segregated with β-thalassaemia trait in a family from China, while co-inheritance with β0-thalassaemia resulted in a markedly reduced β-globin expression and thus Hb A levels in utero.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):Increased expression for ε
Increased expression for Aγ or Gγ
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]
Anaemia [HP:0001903]

Location

Chromosome: 19
Locus: NG_013087.1
Locus Location: 6500
Size: 7 bp
Located at: KLF1
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Chinese, Vietnamese, Korean, Thai
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Gallienne AE, Dréau HM, Schuh A, Old JM, Henderson S, Ten novel mutations in the erythroid transcription factor KLF1 gene associated with increased fetal hemoglobin levels in adults., Haematologica , 97(3), 340-3, 2012 PubMed
  2. Wang Z, Luo G, Ji Y, A novel 519_525dup mutation of KLF1 gene identified in a Chinese blood donor with Lu(a-b-) phenotype., Transfusion , 53(7), 1619-20, 2013 PubMed
  3. Viprakasit V, Ekwattanakit S, Riolueang S, Chalaow N, Fisher C, Lower K, Kanno H, Tachavanich K, Bejrachandra S, Saipin J, Juntharaniyom M, Sanpakit K, Tanphaichitr VS, Songdej D, Babbs C, Gibbons RJ, Philipsen S, Higgs DR, Mutations in Kruppel-like factor 1 cause transfusion-dependent hemolytic anemia and persistence of embryonic globin gene expression., Blood , 2014 PubMed
  4. Lou JW, Li DZ, Zhang Y, He Y, Sun MN, Ye WL, Liu YH, Delineation of the molecular basis of borderline hemoglobin A2 in Chinese individuals., Blood Cells Mol. Dis. , 2014 PubMed
  5. Liu D, Zhang X, Yu L, Cai R, Ma X, Zheng C, Zhou Y, Liu Q, Wei X, Lin L, Yan T, Huang J, Mohandas N, An X, Xu X, Erythroid Krüppel-like factor mutations are relatively more common in a thalassemia endemic region and ameliorate the clinical and hematological severity of β-thalassemia., Blood , 2014 PubMed
  6. Huang LY, Li J, Zhang Y, Li DZ, A KLF1 gene mutation causes β-thalassemia minor in a Chinese family., Int J Lab Hematol , 40(2), e35-e37, 2018 PubMed
  7. Xie XM, Liu YN, Li J, Jiang F, Li DZ, A Gene Mutation Ameliorates the Severity of -Thalassemia: A Case Report., Hemoglobin, 43(2), 137-139, 2019 PubMed
Created on 2013-06-28 13:12:27, Last reviewed on 2019-11-04 16:27:53 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.