IthaID: 2075
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs6706648 | HGVS Name: | NG_011968.1:g.63594G>A |
Context nucleotide sequence:
GAGAGGAAAAAGGAAAAGAATATGA [C/T] GTCAGGGGGAGGCAAGTCAGTTGGG (Strand: +)
Also known as:
Comments: SNP associated with variation in F-cell numbers in individuals of African ancestry with sickle cell disease (SCD) from the Silent Infarct Transfusion (SIT) Trial cohort (n=440). It strongly associated with elevated HbF in individuals with SCD acquired from the Cooperative Study of Sickle Cell Disease (CSSCD), the Comprehensive Sickle Cell Centers Collaborative Data (CDATA) study and the Thomas Jefferson University (n=254). It also associated with varying levels of HbF in patients of Saudi Arab (from Eastern Province) origin with SCD. Homozygosity for the C allele associated with increased HbF in African American Benin haplotype patients (study sample from CSSCD).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] F-cell numbers |
Location
Chromosome: | 2 |
---|---|
Locus: | NG_011968.1 |
Locus Location: | 63594 |
Size: | 1 bp |
Located at: | BCL11A |
Specific Location: | Intron 2 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African, African American, Saudi Arab |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
- Bhatnagar P, Purvis S, Barron-Casella E, DeBaun MR, Casella JF, Arking DE, Keefer JR, Genome-wide association study identifies genetic variants influencing F-cell levels in sickle-cell patients., J. Hum. Genet. , 56(4), 316-23, 2011 PubMed
- Sebastiani P, Farrell JJ, Alsultan A, Wang S, Edward HL, Shappell H, Bae H, Milton JN, Baldwin CT, Al-Rubaish AM, Naserullah Z, Al-Muhanna F, Alsuliman A, Patra PK, Farrer LA, Ngo D, Vathipadiekal V, Chui DH, Al-Ali AK, Steinberg MH, BCL11A enhancer haplotypes and fetal hemoglobin in sickle cell anemia., Blood Cells Mol. Dis. , 54(3), 224-30, 2015 PubMed
- Liu L, Pertsemlidis A, Ding LH, Story MD, Steinberg MH, Sebastiani P, Hoppe C, Ballas SK, Pace BS, A case-control genome-wide association study identifies genetic modifiers of fetal hemoglobin in sickle cell disease., Exp. Biol. Med. (Maywood) , 2016 PubMed
- Shaikho EM, Farrell JJ, Alsultan A, Sebastiani P, Steinberg MH, Genetic Determinants of HbF in Saudi Arabian and African Benin Haplotype Sickle Cell Anemia., Am. J. Hematol. , 2017 PubMed
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2013-06-28 12:32:04 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:00:14 | The IthaGenes Curation Team | Reviewed. |
3 | 2015-05-11 16:03:03 | The IthaGenes Curation Team | Reviewed. Common name and context sequence corrected. |
4 | 2016-05-17 18:02:55 | The IthaGenes Curation Team | Reviewed. |
5 | 2016-05-17 18:04:10 | The IthaGenes Curation Team | Reviewed. |
6 | 2016-08-17 15:44:49 | The IthaGenes Curation Team | Reviewed. Update of mutation comment section. Update of ethnic origin field. Reference added. |
7 | 2017-07-06 16:17:31 | The IthaGenes Curation Team | Reviewed. Mutation Comment section updated. Reference added. |
8 | 2017-07-06 16:52:26 | The IthaGenes Curation Team | Reviewed. Mutation Comment section updated. |