IthaID: 2074



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs7606173 HGVS Name: NG_011968.1:g.60183C>G

Context nucleotide sequence:
CACTGAAGGCTGGGCACAGCCTTGG [C/G] GACCGCTCACAGGACATGCAGCAGT (Strand: +)

Also known as:

Comments: SNP in DHS +55. Associated with variation in F-cell number in individuals of African ancestry with sickle cell disease (SCD) from the Silent Infarct Transfusion (SIT) Trial cohort. Associated with HbF levels in normal subjects of Portuguese origin. The ancestral allele (G) is the major allele and is associated with higher F-cell levels. Associated with varying levels of HbF in sickle cell anaemia patients of African American (CSSCD study) and Saudi Arab (from Eastern Province) origin. Homozygosity for the G allele associated with increased HbF in African American Benin haplotype patients (study sample from CSSCD). The C allele associated with HbF in Kuwaiti patients with SCD, where the CC genotype strongly associated with low HbF levels. SNP was found in moderate LD (r^2 = 0.5) with rs6709302 [PMID: 34204365].

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]
F-cell numbers

Location

Chromosome: 2
Locus: NG_011968.1
Locus Location: 60183
Size: 1 bp
Located at: BCL11A
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African, African American, Saudi Arab, Portuguese, Kawaiti
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Bhatnagar P, Purvis S, Barron-Casella E, DeBaun MR, Casella JF, Arking DE, Keefer JR, Genome-wide association study identifies genetic variants influencing F-cell levels in sickle-cell patients., J. Hum. Genet. , 56(4), 316-23, 2011 PubMed
  2. Sebastiani P, Farrell JJ, Alsultan A, Wang S, Edward HL, Shappell H, Bae H, Milton JN, Baldwin CT, Al-Rubaish AM, Naserullah Z, Al-Muhanna F, Alsuliman A, Patra PK, Farrer LA, Ngo D, Vathipadiekal V, Chui DH, Al-Ali AK, Steinberg MH, BCL11A enhancer haplotypes and fetal hemoglobin in sickle cell anemia., Blood Cells Mol. Dis. , 54(3), 224-30, 2015 PubMed
  3. Pereira C, Relvas L, Bento C, Abade A, Ribeiro ML, Manco L, Polymorphic variations influencing fetal hemoglobin levels: association study in beta-thalassemia carriers and in normal individuals of Portuguese origin., Blood Cells Mol. Dis. , 54(4), 315-20, 2015 PubMed
  4. Shaikho EM, Farrell JJ, Alsultan A, Sebastiani P, Steinberg MH, Genetic Determinants of HbF in Saudi Arabian and African Benin Haplotype Sickle Cell Anemia., Am. J. Hematol. , 2017 PubMed
  5. Akbulut-Jeradi N, Fernandez MJ, Al Khaldi R, Sukumaran J, Adekile A, Unique Polymorphisms at , and Loci Associated with HbF in Kuwaiti Patients with Sickle Cell Disease., J Pers Med, 11(6), , 2021 PubMed
Created on 2013-06-28 12:27:41, Last reviewed on 2021-09-23 12:15:22 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.