IthaID: 2074



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs7606173 HGVS Name: NG_011968.1:g.60183C>G

Context nucleotide sequence:
CACTGAAGGCTGGGCACAGCCTTGG [C/G] GACCGCTCACAGGACATGCAGCAGT (Strand: +)

Comments: SNP associated with variation in F-cell number in individuals of African ancestry with sickle cell disease from the Silent Infarct Transfusion (SIT) Trial cohort (n=440). It also associated with HbF levels in normal subjects of Portuguese origin. The ancestral allele (G) is the major allele and is associated with higher F-cell levels. It also associated with varying levels of HbF in sickle cell anaemia patients of African American (CSSCD study) and Saudi Arab (from Eastern Province) origin. Homozygosity for the G allele associated with increased HbF in African American Benin haplotype patients (study sample from CSSCD).

External Links

Location

Chromosome: 2
Locus: NG_011968.1
Locus Location: 60183
Size: 1 bp
Located at: BCL11A
Specific Location: Intron 2

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]
F-cell numbers

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African, African American, Saudi Arab, Portuguese
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Bhatnagar P, Purvis S, Barron-Casella E, DeBaun MR, Casella JF, Arking DE, Keefer JR, Genome-wide association study identifies genetic variants influencing F-cell levels in sickle-cell patients., J. Hum. Genet. , 56(4), 316-23, 2011 PubMed
  2. Sebastiani P, Farrell JJ, Alsultan A, Wang S, Edward HL, Shappell H, Bae H, Milton JN, Baldwin CT, Al-Rubaish AM, Naserullah Z, Al-Muhanna F, Alsuliman A, Patra PK, Farrer LA, Ngo D, Vathipadiekal V, Chui DH, Al-Ali AK, Steinberg MH, BCL11A enhancer haplotypes and fetal hemoglobin in sickle cell anemia., Blood Cells Mol. Dis. , 54(3), 224-30, 2015 PubMed
  3. Pereira C, Relvas L, Bento C, Abade A, Ribeiro ML, Manco L, Polymorphic variations influencing fetal hemoglobin levels: association study in beta-thalassemia carriers and in normal individuals of Portuguese origin., Blood Cells Mol. Dis. , 54(4), 315-20, 2015 PubMed
  4. Shaikho EM, Farrell JJ, Alsultan A, Sebastiani P, Steinberg MH, Genetic Determinants of HbF in Saudi Arabian and African Benin Haplotype Sickle Cell Anemia., Am. J. Hematol. , 2017 PubMed
Created on 2013-06-28 12:27:41, Last reviewed on 2017-07-06 16:55:38 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.