IthaID: 2072

Context nucleotide sequence:
TTCGCTTTAGCTTTATTAAGGTATA [A/C] TTTACATACAACAAAAGTCATTCAT (Strand: +)

Also known as:

Comments: SNP associated with variation in F-cell number in healthy Northern Europeans (TwinsUK cohort). It strongly associated with HbF levels in individuals with African ancestry from the Cooperative Study of Sickle Cell Disease (CSSCD) and the Silent Infarct Transfusion (SIT) Trial cohort. Associated with increased HbF levels as well as clinical outcomes (risk of pain episodes and transfusion requirements) in pediatric patients with SCA from southeastern Brazil (n=250). It associated with HbF levels and F-cell numbers in Chinese with β-thalassaemia (n=250 and n=312; two independent studies), Thais with β-thalassaemia and/or HbE trait, Southern Thais with heterozygous Hb E (n=74), as well as individuals from Hong-Kong with heterozygous β-thalassaemia (n=406). It associated with disease severity in Thai β0-thalassaemia/HbE patients. SNP exhibited a modifying effect on HbF and clinical score in Indonesian HbE/β-thal patients. SNP associated with HbF levels in both the Portuguese normal subjects and β-thalassaemia carriers. It associated with HbF levels in African American Benin haplotype patients (study sample from CSSCD). The presence of the 'C' allele associated with response to hydroxyurea (HU) in Iranian β-Thalassemia patients. Also, homozygosity for 'C' allele associated with response to HU in SCD patients (n=42) from Brazil (increased Hb concentration, RBC count, and hematocrit, as well as lower platelet count and direct bilirubin).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Heterozygous records (preview in IthaPhen)

1. Menzel S, Garner C, Gut I, Matsuda F, Yamaguchi M, Heath S, Foglio M, Zelenika D, Boland A, Rooks H, Best S, Spector TD, Farrall M, Lathrop M, Thein SL, A QTL influencing F cell production maps to a gene encoding a zinc-finger protein on chromosome 2p15., Nat. Genet. , 39(10), 1197-9, 2007 PubMed
2. Sedgewick AE, Timofeev N, Sebastiani P, So JC, Ma ES, Chan LC, Fucharoen G, Fucharoen S, Barbosa CG, Vardarajan BN, Farrer LA, Baldwin CT, Steinberg MH, Chui DH, BCL11A is a major HbF quantitative trait locus in three different populations with beta-hemoglobinopathies., Blood Cells Mol. Dis. , 41(3), 255-8, 2008 PubMed
3. Solovieff N, Milton JN, Hartley SW, Sherva R, Sebastiani P, Dworkis DA, Klings ES, Farrer LA, Garrett ME, Ashley-Koch A, Telen MJ, Fucharoen S, Ha SY, Li CK, Chui DH, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: genome-wide association studies suggest a regulatory region in the 5' olfactory receptor gene cluster., Blood , 115(9), 1815-22, 2010 PubMed
4. Nuinoon M, Makarasara W, Mushiroda T, Setianingsih I, Wahidiyat PA, Sripichai O, Kumasaka N, Takahashi A, Svasti S, Munkongdee T, Mahasirimongkol S, Peerapittayamongkol C, Viprakasit V, Kamatani N, Winichagoon P, Kubo M, Nakamura Y, Fucharoen S, A genome-wide association identified the common genetic variants influence disease severity in beta0-thalassemia/hemoglobin E., Hum. Genet. , 127(3), 303-14, 2010 PubMed
5. Bhatnagar P, Purvis S, Barron-Casella E, DeBaun MR, Casella JF, Arking DE, Keefer JR, Genome-wide association study identifies genetic variants influencing F-cell levels in sickle-cell patients., J. Hum. Genet. , 56(4), 316-23, 2011 PubMed
6. He Y, Lin W, Luo J, Influences of genetic variation on fetal hemoglobin., Pediatr Hematol Oncol , 28(8), 708-17, 2011 PubMed
7. Farrell JJ, Sherva RM, Chen ZY, Luo HY, Chu BF, Ha SY, Li CK, Lee AC, Li RC, Li CK, Yuen HL, So JC, Ma ES, Chan LC, Chan V, Sebastiani P, Farrer LA, Baldwin CT, Steinberg MH, Chui DH, A 3-bp deletion in the HBS1L-MYB intergenic region on chromosome 6q23 is associated with HbF expression., Blood , 117(18), 4935-45, 2011 PubMed
8. Banan M, Bayat H, Azarkeivan A, Mohammadparast S, Kamali K, Farashi S, Bayat N, Khani MH, Neishabury M, Najmabadi H, The XmnI and BCL11A single nucleotide polymorphisms may help predict hydroxyurea response in Iranian β-thalassemia patients., Hemoglobin , 36(4), 371-80, 2012 PubMed
9. Green NS, Ender KL, Pashankar F, Driscoll C, Giardina PJ, Mullen CA, Clark LN, Manwani D, Crotty J, Kisselev S, Neville KA, Hoppe C, Barral S, Candidate sequence variants and fetal hemoglobin in children with sickle cell disease treated with hydroxyurea., PLoS ONE , 8(2), e55709, 2013 PubMed
10. Green NS, Barral S, Emerging science of hydroxyurea therapy for pediatric sickle cell disease., Pediatr. Res. , 75(1), 196-204, 2014 PubMed
11. Pereira C, Relvas L, Bento C, Abade A, Ribeiro ML, Manco L, Polymorphic variations influencing fetal hemoglobin levels: association study in beta-thalassemia carriers and in normal individuals of Portuguese origin., Blood Cells Mol. Dis. , 54(4), 315-20, 2015 PubMed
12. Rujito L, Basalamah M, Siswandari W, Setyono J, Wulandari G, Mulatsih S, Sofro AS, Sadewa AH, Sutaryo S, Modifying effect of XmnI, BCL11A, and HBS1L-MYB on clinical appearances: A study on β-thalassemia and hemoglobin E/β-thalassemia patients in Indonesia., Hematol Oncol Stem Cell Ther , 9(2), 55-63, 2016 PubMed
13. Liu L, Pertsemlidis A, Ding LH, Story MD, Steinberg MH, Sebastiani P, Hoppe C, Ballas SK, Pace BS, A case-control genome-wide association study identifies genetic modifiers of fetal hemoglobin in sickle cell disease., Exp. Biol. Med. (Maywood) , 2016 PubMed
14. Shaikho EM, Farrell JJ, Alsultan A, Sebastiani P, Steinberg MH, Genetic Determinants of HbF in Saudi Arabian and African Benin Haplotype Sickle Cell Anemia., Am. J. Hematol. , 2017 PubMed
15. Aleluia MM, Santiago RP, da Guarda CC, Fonseca TC, Neves FI, Quinto RS, Figueiredo CV, Yahouédéhou SC, Oliveira RM, Ferreira JR, Cerqueira BA, Barbosa CG, Milton JN, Steinberg MH, de Souza Gonçalves M, Genetic modulation of fetal hemoglobin in hydroxyurea-treated sickle cell anemia., Am. J. Hematol., 92(5), E70-E72, 2017 PubMed
16. Kesornsit A, Jeenduang N, Horpet D, Plyduang T, Nuinoon M, Quantitative Trait Loci Influencing Hb F Levels in Southern Thai Hb E (HBB: c.79G>A) Heterozygotes., Hemoglobin , 2018 PubMed
17. Sales RR, Belisário AR, Faria G, Mendes F, Luizon MR, Viana MB, Functional polymorphisms of BCL11A and HBS1L-MYB genes affect both fetal hemoglobin level and clinical outcomes in a cohort of children with sickle cell anemia., Ann Hematol, 99(7), 1453-1463, 2020 PubMed