IthaID: 2072



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs766432 HGVS Name: NG_011968.1:g.65664G>T

Context nucleotide sequence:
TTCGCTTTAGCTTTATTAAGGTATA [A/C] TTTACATACAACAAAAGTCATTCAT (Strand: +)

Comments: SNP associated with variation in F-cell number in healthy Northern Europeans (TwinsUK cohort). It strongly associated with HbF levels in individuals with African ancestry from the Cooperative Study of Sickle Cell Disease (CSSCD) and the Silent Infarct Transfusion (SIT) Trial cohort. It associated with HbF levels and F-cell numbers in Chinese with β-thalassaemia (n=250 and n=312; two independent studies), Thais with β-thalassaemia and/or HbE trait, Southern Thais with heterozygous Hb E (n=74), as well as individuals from Hong-Kong with heterozygous β-thalassaemia (n=406). It associated with disease severity in Thai β0-thalassaemia/HbE patients. SNP exhibited a modifying effect on HbF and clinical score in Indonesian HbE/β-thal patients. SNP associated with HbF levels in both the Portuguese normal subjects and β-thalassaemia carriers. It associated with HbF levels in African American Benin haplotype patients (study sample from CSSCD). Also, the presence of the 'C' allele associated with response to hydroxyurea in Iranian β-Thalassemia Patients.

External Links

Location

Chromosome: 2
Locus: NG_011968.1
Locus Location: 65664
Size: 1 bp
Located at: BCL11A
Specific Location: Intron 2

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]
Hb F response to hydroxyurea
F-cell numbers

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Northern European, African, African American, Chinese, Thai, Hong Kong, Indonesian, Portuguese
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Menzel S, Garner C, Gut I, Matsuda F, Yamaguchi M, Heath S, Foglio M, Zelenika D, Boland A, Rooks H, Best S, Spector TD, Farrall M, Lathrop M, Thein SL, A QTL influencing F cell production maps to a gene encoding a zinc-finger protein on chromosome 2p15., Nat. Genet. , 39(10), 1197-9, 2007 PubMed
  2. Sedgewick AE, Timofeev N, Sebastiani P, So JC, Ma ES, Chan LC, Fucharoen G, Fucharoen S, Barbosa CG, Vardarajan BN, Farrer LA, Baldwin CT, Steinberg MH, Chui DH, BCL11A is a major HbF quantitative trait locus in three different populations with beta-hemoglobinopathies., Blood Cells Mol. Dis. , 41(3), 255-8, 2008 PubMed
  3. Solovieff N, Milton JN, Hartley SW, Sherva R, Sebastiani P, Dworkis DA, Klings ES, Farrer LA, Garrett ME, Ashley-Koch A, Telen MJ, Fucharoen S, Ha SY, Li CK, Chui DH, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: genome-wide association studies suggest a regulatory region in the 5' olfactory receptor gene cluster., Blood , 115(9), 1815-22, 2010 PubMed
  4. Nuinoon M, Makarasara W, Mushiroda T, Setianingsih I, Wahidiyat PA, Sripichai O, Kumasaka N, Takahashi A, Svasti S, Munkongdee T, Mahasirimongkol S, Peerapittayamongkol C, Viprakasit V, Kamatani N, Winichagoon P, Kubo M, Nakamura Y, Fucharoen S, A genome-wide association identified the common genetic variants influence disease severity in beta0-thalassemia/hemoglobin E., Hum. Genet. , 127(3), 303-14, 2010 PubMed
  5. Bhatnagar P, Purvis S, Barron-Casella E, DeBaun MR, Casella JF, Arking DE, Keefer JR, Genome-wide association study identifies genetic variants influencing F-cell levels in sickle-cell patients., J. Hum. Genet. , 56(4), 316-23, 2011 PubMed
  6. He Y, Lin W, Luo J, Influences of genetic variation on fetal hemoglobin., Pediatr Hematol Oncol , 28(8), 708-17, 2011 PubMed
  7. Farrell JJ, Sherva RM, Chen ZY, Luo HY, Chu BF, Ha SY, Li CK, Lee AC, Li RC, Li CK, Yuen HL, So JC, Ma ES, Chan LC, Chan V, Sebastiani P, Farrer LA, Baldwin CT, Steinberg MH, Chui DH, A 3-bp deletion in the HBS1L-MYB intergenic region on chromosome 6q23 is associated with HbF expression., Blood , 117(18), 4935-45, 2011 PubMed
  8. Banan M, Bayat H, Azarkeivan A, Mohammadparast S, Kamali K, Farashi S, Bayat N, Khani MH, Neishabury M, Najmabadi H, The XmnI and BCL11A single nucleotide polymorphisms may help predict hydroxyurea response in Iranian β-thalassemia patients., Hemoglobin , 36(4), 371-80, 2012 PubMed
  9. Green NS, Ender KL, Pashankar F, Driscoll C, Giardina PJ, Mullen CA, Clark LN, Manwani D, Crotty J, Kisselev S, Neville KA, Hoppe C, Barral S, Candidate sequence variants and fetal hemoglobin in children with sickle cell disease treated with hydroxyurea., PLoS ONE , 8(2), e55709, 2013 PubMed
  10. Green NS, Barral S, Emerging science of hydroxyurea therapy for pediatric sickle cell disease., Pediatr. Res. , 75(1), 196-204, 2014 PubMed
  11. Pereira C, Relvas L, Bento C, Abade A, Ribeiro ML, Manco L, Polymorphic variations influencing fetal hemoglobin levels: association study in beta-thalassemia carriers and in normal individuals of Portuguese origin., Blood Cells Mol. Dis. , 54(4), 315-20, 2015 PubMed
  12. Liu L, Pertsemlidis A, Ding LH, Story MD, Steinberg MH, Sebastiani P, Hoppe C, Ballas SK, Pace BS, A case-control genome-wide association study identifies genetic modifiers of fetal hemoglobin in sickle cell disease., Exp. Biol. Med. (Maywood) , 2016 PubMed
  13. Rujito L, Basalamah M, Siswandari W, Setyono J, Wulandari G, Mulatsih S, Sofro AS, Sadewa AH, Sutaryo S, Modifying effect of XmnI, BCL11A, and HBS1L-MYB on clinical appearances: A study on β-thalassemia and hemoglobin E/β-thalassemia patients in Indonesia., Hematol Oncol Stem Cell Ther , 9(2), 55-63, 2016 PubMed
  14. Shaikho EM, Farrell JJ, Alsultan A, Sebastiani P, Steinberg MH, Genetic Determinants of HbF in Saudi Arabian and African Benin Haplotype Sickle Cell Anemia., Am. J. Hematol. , 2017 PubMed
  15. Kesornsit A, Jeenduang N, Horpet D, Plyduang T, Nuinoon M, Quantitative Trait Loci Influencing Hb F Levels in Southern Thai Hb E (HBB: c.79G>A) Heterozygotes., Hemoglobin , 2018 PubMed
Created on 2013-06-28 12:20:11, Last reviewed on 2018-03-26 17:18:00 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.