IthaID: 2071



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs1427407 HGVS Name: NG_011968.1:g.67591A>C

Context nucleotide sequence:
TTAACCTTCTTAGCACCCACAAACA [G/T] TTCCCTTCTGATATCTACTTGAACT (Strand: +)

Comments: SNP associated with variation in F-cell number in healthy Northern Europeans (TwinsUK cohort). It strongly associated with HbF levels in individuals from Sardinia with β0-thalassaemia (n=316) and exhibited strong effect on the severity of the β-thalassaemia phenotype. It associated with varying levels of HbF in individuals with sickle cell anaemia (SCA) from the BABY HUG study (n=95), the Cooperative Study of Sickle Cell Disease (CSSCD), the Comprehensive Sickle Cell Centers Collaborative Data (CDATA) study and the Thomas Jefferson University (n=254). It also associated with HbF levels in SCA patients of Arab Indian and Saudi Arab (from both Eastern and Southwestern Provinces) origin. It associated with HbF levels in individuals with SCA from Tanzania (East African descent, n=1213), as well as in a replication UK cohort of African Caribbean and/or West African descent (n=321). It associated with HbF levels in β-thalassaemia patients from Guangxi, Southern China (n=493). Homozygosity for the T allele associated with increased HbF in African American Benin haplotype patients (study sample from CSSCD). SNP associated with increased HbF and haemoglobin levels, as well as with lower platelet and reticulocyte counts in Nigerian patients with SCA (n=260). SNP significantly influenced baseline serum bilirubin (negative effect) in young patients with SCA (BABY HUG cohort) [PMID: 23606168]. It also associated with fewer pain events in the placebo-treated cohort and with even lower incidence of painful events for the HU-treated cohort [PMID: 23606168]. The BCL11A rs1427407 T variant has been associated with higher haemoglobin concentrations in cohorts with sickle cell anaemia (SCA) [PMID: 29879141, 23606168, 28868518]. Associations with specific SCA-related complications, such as VOC frequency and stroke have shown conflicting results; e.g., the GG and GT genotypes associated with increased risks of VOC and stroke in Sudanese SCA patients [PMID: 30563311], but failed to reach statistical significance in three independent cohorts from the U.S. (University of Ibadan, University of Illinois at Chicago, Walk-PHaSST). Instead, when combining the absence of α-thalassemia with the absence of the BCL11A rs1427407 T variant to define a high risk group of SCA patients from all three cohorts, an increased risk for stroke history was detected [PMID: 28868518]. SNP associated with higher white blood cell counts in cohorts of sickle cell anaemia patients [PMID: 30563311, 28868518].

External Links

Location

Chromosome: 2
Locus: NG_011968.1
Locus Location: 67591
Size: 1 bp
Located at: BCL11A
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: North European, Sardinian, African American, African Caribbean, West African, Tanzanian, Saudi Arab, Arab Indian, Chinese, Nigerian, Sudanese, American
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Menzel S, Garner C, Gut I, Matsuda F, Yamaguchi M, Heath S, Foglio M, Zelenika D, Boland A, Rooks H, Best S, Spector TD, Farrall M, Lathrop M, Thein SL, A QTL influencing F cell production maps to a gene encoding a zinc-finger protein on chromosome 2p15., Nat. Genet. , 39(10), 1197-9, 2007 PubMed
  2. Danjou F, Anni F, Perseu L, Satta S, Dessì C, Lai ME, Fortina P, Devoto M, Galanello R, Genetic modifiers of β-thalassemia and clinical severity as assessed by age at first transfusion., Haematologica , 97(7), 989-93, 2012 PubMed
  3. Sheehan VA, Luo Z, Flanagan JM, Howard TA, Thompson BW, Wang WC, Kutlar A, Ware RE, , Genetic modifiers of sickle cell anemia in the BABY HUG cohort: influence on laboratory and clinical phenotypes., Am. J. Hematol. , 88(7), 571-6, 2013 PubMed
  4. Green NS, Ender KL, Pashankar F, Driscoll C, Giardina PJ, Mullen CA, Clark LN, Manwani D, Crotty J, Kisselev S, Neville KA, Hoppe C, Barral S, Candidate sequence variants and fetal hemoglobin in children with sickle cell disease treated with hydroxyurea., PLoS ONE , 8(2), e55709, 2013 PubMed
  5. Sebastiani P, Farrell JJ, Alsultan A, Wang S, Edward HL, Shappell H, Bae H, Milton JN, Baldwin CT, Al-Rubaish AM, Naserullah Z, Al-Muhanna F, Alsuliman A, Patra PK, Farrer LA, Ngo D, Vathipadiekal V, Chui DH, Al-Ali AK, Steinberg MH, BCL11A enhancer haplotypes and fetal hemoglobin in sickle cell anemia., Blood Cells Mol. Dis. , 54(3), 224-30, 2015 PubMed
  6. Liu L, Pertsemlidis A, Ding LH, Story MD, Steinberg MH, Sebastiani P, Hoppe C, Ballas SK, Pace BS, A case-control genome-wide association study identifies genetic modifiers of fetal hemoglobin in sickle cell disease., Exp. Biol. Med. (Maywood) , 2016 PubMed
  7. Yi S, Lai Y, Zuo Y, Chen Y, Qin H, Wei Y, Yang Q, Lin L, Luo J, Fan X, Zheng C, Common genetic polymorphisms at three loci affect HbF levels in β-thalassemia patients from Southern China., Blood Cells Mol. Dis. , 62(0), 22-23, 2016 PubMed
  8. Shaikho EM, Farrell JJ, Alsultan A, Sebastiani P, Steinberg MH, Genetic Determinants of HbF in Saudi Arabian and African Benin Haplotype Sickle Cell Anemia., Am. J. Hematol. , 2017 PubMed
  9. Saraf SL, Akingbola TS, Shah BN, Ezekekwu CA, Sonubi O, Zhang X, Hsu LL, Gladwin MT, Machado RF, Cooper RS, Gordeuk VR, Tayo BO, Associations of α-thalassemia and BCL11A with stroke in Nigerian, United States, and United Kingdom sickle cell anemia cohorts., Blood Adv, 1(11), 693-698, 2017 PubMed
  10. Adeyemo TA, Ojewunmi OO, Oyetunji IA, Rooks H, Rees DC, Akinsulie AO, Akanmu AS, Thein SL, Menzel S, A survey of genetic fetal-haemoglobin modifiers in Nigerian patients with sickle cell anaemia., PLoS ONE , 13(6), e0197927, 2018 PubMed
  11. Hassan FM, Al-Zahrani FM, BCL11A rs1427407 Genotypes in Sickle Cell Anemia Patients Undergo to Stroke Problems in Sudan., Korean J Fam Med, 40(1), 53-57, 2019 PubMed
Created on 2013-06-28 12:14:23, Last reviewed on 2019-07-03 15:56:31 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.