IthaID: 2069

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	rs10189857	HGVS Name:	NG_011968.1:g.72399T>C

Context nucleotide sequence:
CCCCTTGTTCTATCAGCAGGTCAAG [A/G] GTAGAGAACTGTGACAAGCTGTTCT (Strand: +)

Also known as:

Comments: Sardinia; effect on the severity of β-thalassaemia phenotype.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	N/A
Associated Phenotypes:	N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	2
Locus:	NG_011968.1
Locus Location:	72399
Size:	1 bp
Located at:	BCL11A
Specific Location:	Intron 2

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	African American, Sardinian
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Galarneau G, Palmer CD, Sankaran VG, Orkin SH, Hirschhorn JN, Lettre G, Fine-mapping at three loci known to affect fetal hemoglobin levels explains additional genetic variation., Nat. Genet. , 42(12), 1049-51, 2010 PubMed
Danjou F, Anni F, Perseu L, Satta S, Dessì C, Lai ME, Fortina P, Devoto M, Galanello R, Genetic modifiers of β-thalassemia and clinical severity as assessed by age at first transfusion., Haematologica , 97(7), 989-93, 2012 PubMed

Created on 2013-06-28 12:05:32, Last reviewed on 2019-07-03 13:33:03 (Show full history)

A/A	Date	Curator(s)	Comments
1	2013-06-28 12:05:32	The IthaGenes Curation Team	Created
2	2013-10-15 17:00:14	The IthaGenes Curation Team	Reviewed.
3	2015-05-11 15:50:31	The IthaGenes Curation Team	Reviewed. Common name and context sequence corrected.
4	2016-05-17 16:59:15	The IthaGenes Curation Team	Reviewed.
5	2019-07-03 13:33:03	The IthaGenes Curation Team	Reviewed. Clinical phenotype corrected.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.