IthaID: 2068

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	rs6732518	HGVS Name:	NG_011968.1:g.77037G>A

Context nucleotide sequence:
ACACCCCACCCACCACAAGCACATA [C/T] ACATGCTCTCAGGAGTCAGAGGGTC (Strand: +)

Also known as:

Comments: SNP associated with HbF levels and F-cell number variation in healthy Northern Europeans (TwinsUK cohort) and in individuals of African ancestry with sickle cell disease from the Cooperative Study of Sickle Cell Disease and the Silent Infarct Transfusion (SIT) Trial cohort. Associated with HbF levels in individuals from Thailand with heterozygous HbE and β-thalassemia.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	N/A
Associated Phenotypes:	Hb F levels [HP:0011904] [OMIM:141749] F-cell numbers

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	2
Locus:	NG_011968.1
Locus Location:	77037
Size:	1 bp
Located at:	BCL11A
Specific Location:	Intron 2

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	Northern European, African, African American, Thai
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Menzel S, Garner C, Gut I, Matsuda F, Yamaguchi M, Heath S, Foglio M, Zelenika D, Boland A, Rooks H, Best S, Spector TD, Farrall M, Lathrop M, Thein SL, A QTL influencing F cell production maps to a gene encoding a zinc-finger protein on chromosome 2p15., Nat. Genet. , 39(10), 1197-9, 2007 PubMed
Sedgewick AE, Timofeev N, Sebastiani P, So JC, Ma ES, Chan LC, Fucharoen G, Fucharoen S, Barbosa CG, Vardarajan BN, Farrer LA, Baldwin CT, Steinberg MH, Chui DH, BCL11A is a major HbF quantitative trait locus in three different populations with beta-hemoglobinopathies., Blood Cells Mol. Dis. , 41(3), 255-8, 2008 PubMed
Solovieff N, Milton JN, Hartley SW, Sherva R, Sebastiani P, Dworkis DA, Klings ES, Farrer LA, Garrett ME, Ashley-Koch A, Telen MJ, Fucharoen S, Ha SY, Li CK, Chui DH, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: genome-wide association studies suggest a regulatory region in the 5' olfactory receptor gene cluster., Blood , 115(9), 1815-22, 2010 PubMed
Bhatnagar P, Purvis S, Barron-Casella E, DeBaun MR, Casella JF, Arking DE, Keefer JR, Genome-wide association study identifies genetic variants influencing F-cell levels in sickle-cell patients., J. Hum. Genet. , 56(4), 316-23, 2011 PubMed

Created on 2013-06-28 11:54:54, Last reviewed on 2016-05-17 16:53:24 (Show full history)

A/A	Date	Curator(s)	Comments
1	2013-06-28 11:54:54	The IthaGenes Curation Team	Created
2	2013-10-15 17:00:14	The IthaGenes Curation Team	Reviewed.
3	2015-05-11 15:47:07	The IthaGenes Curation Team	Reviewed. Common name and context sequence corrected.
4	2016-05-17 16:52:12	The IthaGenes Curation Team	Reviewed.
5	2016-05-17 16:53:24	The IthaGenes Curation Team	Reviewed.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.