IthaID: 2066

Context nucleotide sequence:
CCAGTGCTGTGGACAGCAAAGCTTC [A/G] GTGCAGGAAATTAAGATTCCCCCTG (Strand: +)

Also known as:

Comments: Associated with variation in F-cell number in healthy Northern Europeans (TwinsUK cohort). Strongly associated with HbF levels in the Cooperative Study of Sickle Cell Disease (CSSCD), in patients with sickle cell disease (SCD) from Brazil, Cameroon and Tunisia, in β-thalassaemia patients from China, and in individuals from Thailand with homozygous HbE. Associated with increased HbF levels as well as clinical outcomes (acute chest syndrome and infection risk, and transfusion requirements) and haematological parameters (total Hb levels) in pediatric patients with SCA from southeastern Brazil (n=250). Associated with HbF levels in African American Benin haplotype patients (study sample from CSSCD). SNP associated with disease severity and HbF levels in Indian SCD patients. SNP associated with HbF levels in individuals from the SardiNIA study. SNP associated with baseline and hydroxyurea-induced HbF in pediatric sickle cell anaemia (HU-induced HbF significance is lost after Bonferroni correction) [PMID: 23409025]. Nominal association with acute chest syndrome in pediatric patients with SCA from southeastern Brazil (n=250).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Heterozygous records (preview in IthaPhen)

1. Menzel S, Garner C, Gut I, Matsuda F, Yamaguchi M, Heath S, Foglio M, Zelenika D, Boland A, Rooks H, Best S, Spector TD, Farrall M, Lathrop M, Thein SL, A QTL influencing F cell production maps to a gene encoding a zinc-finger protein on chromosome 2p15., Nat. Genet. , 39(10), 1197-9, 2007 PubMed
2. Lettre G, Sankaran VG, Bezerra MA, Araújo AS, Uda M, Sanna S, Cao A, Schlessinger D, Costa FF, Hirschhorn JN, Orkin SH, DNA polymorphisms at the BCL11A, HBS1L-MYB, and beta-globin loci associate with fetal hemoglobin levels and pain crises in sickle cell disease., Proc. Natl. Acad. Sci. U.S.A. , 105(33), 11869-74, 2008 PubMed
3. Galarneau G, Palmer CD, Sankaran VG, Orkin SH, Hirschhorn JN, Lettre G, Fine-mapping at three loci known to affect fetal hemoglobin levels explains additional genetic variation., Nat. Genet. , 42(12), 1049-51, 2010 PubMed
4. He Y, Lin W, Luo J, Influences of genetic variation on fetal hemoglobin., Pediatr Hematol Oncol , 28(8), 708-17, 2011 PubMed
5. Green NS, Ender KL, Pashankar F, Driscoll C, Giardina PJ, Mullen CA, Clark LN, Manwani D, Crotty J, Kisselev S, Neville KA, Hoppe C, Barral S, Candidate sequence variants and fetal hemoglobin in children with sickle cell disease treated with hydroxyurea., PLoS ONE , 8(2), e55709, 2013 PubMed
6. Cardoso GL, Diniz IG, Silva AN, Cunha DA, Silva Junior JS, Uchôa CT, Santos SE, Trindade SM, Cardoso Mdo S, Guerreiro JF, DNA polymorphisms at BCL11A, HBS1L-MYB and Xmn1-HBG2 site loci associated with fetal hemoglobin levels in sickle cell anemia patients from Northern Brazil., Blood Cells Mol. Dis. , 53(4), 176-9, 2014 PubMed
7. Wonkam A, Ngo Bitoungui VJ, Vorster AA, Ramesar R, Cooper RS, Tayo B, Lettre G, Ngogang J, Association of variants at BCL11A and HBS1L-MYB with hemoglobin F and hospitalization rates among sickle cell patients in Cameroon., PLoS ONE , 9(3), e92506, 2014 PubMed
8. Pakdee N, Yamsri S, Fucharoen G, Sanchaisuriya K, Pissard S, Fucharoen S, Variability of hemoglobin F expression in hemoglobin EE disease: hematological and molecular analysis., Blood Cells Mol. Dis. , 53(1), 11-5, 2014 PubMed
9. Green NS, Barral S, Emerging science of hydroxyurea therapy for pediatric sickle cell disease., Pediatr. Res. , 75(1), 196-204, 2014 PubMed
10. Danjou F, Zoledziewska M, Sidore C, Steri M, Busonero F, Maschio A, Mulas A, Perseu L, Barella S, Porcu E, Pistis G, Pitzalis M, Pala M, Menzel S, Metrustry S, Spector TD, Leoni L, Angius A, Uda M, Moi P, Thein SL, Galanello R, Abecasis GR, Schlessinger D, Sanna S, Cucca F, Genome-wide association analyses based on whole-genome sequencing in Sardinia provide insights into regulation of hemoglobin levels., Nat. Genet. , 47(11), 1264-71, 2015 PubMed
11. Liu L, Pertsemlidis A, Ding LH, Story MD, Steinberg MH, Sebastiani P, Hoppe C, Ballas SK, Pace BS, A case-control genome-wide association study identifies genetic modifiers of fetal hemoglobin in sickle cell disease., Exp. Biol. Med. (Maywood) , 2016 PubMed
12. Chaouch L, Moumni I, Ouragini H, Darragi I, Kalai M, Chaouachi D, Boudrigua I, Hafsia R, Abbes S, rs11886868 and rs4671393 of BCL11A associated with HbF level variation and modulate clinical events among sickle cell anemia patients., Hematology , 21(7), 425-9, 2016 PubMed
13. Upadhye D, Jain D, Trivedi Y, Nadkarni A, Ghosh K, Colah R, Influence of single nucleotide polymorphisms in the BCL11A and HBS1L-MYB gene on the HbF levels and clinical severity of sickle cell anaemia patients., Ann. Hematol. , 95(7), 1201-3, 2016 PubMed
14. Shaikho EM, Farrell JJ, Alsultan A, Sebastiani P, Steinberg MH, Genetic Determinants of HbF in Saudi Arabian and African Benin Haplotype Sickle Cell Anemia., Am. J. Hematol. , 2017 PubMed
15. Sales RR, Belisário AR, Faria G, Mendes F, Luizon MR, Viana MB, Functional polymorphisms of BCL11A and HBS1L-MYB genes affect both fetal hemoglobin level and clinical outcomes in a cohort of children with sickle cell anemia., Ann Hematol, 99(7), 1453-1463, 2020 PubMed