IthaID: 2065



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs11886868 HGVS Name: NG_011968.1:g.65388G>A

Context nucleotide sequence:
TATCGTCTTTTGTGTTTAATTTCTT [C/T] CACAGAGCAGAATGATTCTGGGATT (Strand: +)

Comments: SNP associated with elevated HbF in the general (non-anaemic) population of Sardinia (n=4305 in the initial screen, n=521 in the follow-up sample). It also associated with HbF levels in Portuguese normal subjects. SNP associated with HbF level variation in β-thalassaemia cohorts from Sardinia (n=126) and France (n=106), and in sickle cell disease cohorts from Brasil (n=350), Cameroon (n=596), and Tunisia (n=148). The association was replicated in the Cooperative Study of Sickle Cell Disease (CSSCD; n=1242 and n=1275 from two independent studies), as well as in an independent study sample acquired from the CSSCD, the Comprehensive Sickle Cell Centers Collaborative Data (CDATA) study and the Thomas Jefferson University (n=254). The association was not replicated in Chinese β-thalassemia patients (n=312). SNP exhibited a modifying effect on HbF and clinical score in Indonesian HbE/β-thal patients.

External Links

Location

Chromosome: 2
Locus: NG_011968.1
Locus Location: 65388
Size: 1 bp
Located at: BCL11A
Specific Location: Intron 2

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American, Sardinian, Brazilian, Cameroonian, French, Indonesian, Tunisian, Portuguese
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Uda M, Galanello R, Sanna S, Lettre G, Sankaran VG, Chen W, Usala G, Busonero F, Maschio A, Albai G, Piras MG, Sestu N, Lai S, Dei M, Mulas A, Crisponi L, Naitza S, Asunis I, Deiana M, Nagaraja R, Perseu L, Satta S, Cipollina MD, Sollaino C, Moi P, Hirschhorn JN, Orkin SH, Abecasis GR, Schlessinger D, Cao A, Genome-wide association study shows BCL11A associated with persistent fetal hemoglobin and amelioration of the phenotype of beta-thalassemia., Proc. Natl. Acad. Sci. U.S.A. , 105(5), 1620-5, 2008 PubMed
  2. Lettre G, Sankaran VG, Bezerra MA, Araújo AS, Uda M, Sanna S, Cao A, Schlessinger D, Costa FF, Hirschhorn JN, Orkin SH, DNA polymorphisms at the BCL11A, HBS1L-MYB, and beta-globin loci associate with fetal hemoglobin levels and pain crises in sickle cell disease., Proc. Natl. Acad. Sci. U.S.A. , 105(33), 11869-74, 2008 PubMed
  3. Badens C, Joly P, Agouti I, Thuret I, Gonnet K, Fattoum S, Francina A, Simeoni MC, Loundou A, Pissard S, Variants in genetic modifiers of β-thalassemia can help to predict the major or intermedia type of the disease., Haematologica , 96(11), 1712-4, 2011 PubMed
  4. He Y, Lin W, Luo J, Influences of genetic variation on fetal hemoglobin., Pediatr Hematol Oncol , 28(8), 708-17, 2011 PubMed
  5. Green NS, Ender KL, Pashankar F, Driscoll C, Giardina PJ, Mullen CA, Clark LN, Manwani D, Crotty J, Kisselev S, Neville KA, Hoppe C, Barral S, Candidate sequence variants and fetal hemoglobin in children with sickle cell disease treated with hydroxyurea., PLoS ONE , 8(2), e55709, 2013 PubMed
  6. Wonkam A, Ngo Bitoungui VJ, Vorster AA, Ramesar R, Cooper RS, Tayo B, Lettre G, Ngogang J, Association of variants at BCL11A and HBS1L-MYB with hemoglobin F and hospitalization rates among sickle cell patients in Cameroon., PLoS ONE , 9(3), e92506, 2014 PubMed
  7. Green NS, Barral S, Emerging science of hydroxyurea therapy for pediatric sickle cell disease., Pediatr. Res. , 75(1), 196-204, 2014 PubMed
  8. Pereira C, Relvas L, Bento C, Abade A, Ribeiro ML, Manco L, Polymorphic variations influencing fetal hemoglobin levels: association study in beta-thalassemia carriers and in normal individuals of Portuguese origin., Blood Cells Mol. Dis. , 54(4), 315-20, 2015 PubMed
  9. Liu L, Pertsemlidis A, Ding LH, Story MD, Steinberg MH, Sebastiani P, Hoppe C, Ballas SK, Pace BS, A case-control genome-wide association study identifies genetic modifiers of fetal hemoglobin in sickle cell disease., Exp. Biol. Med. (Maywood) , 2016 PubMed
  10. Rujito L, Basalamah M, Siswandari W, Setyono J, Wulandari G, Mulatsih S, Sofro AS, Sadewa AH, Sutaryo S, Modifying effect of XmnI, BCL11A, and HBS1L-MYB on clinical appearances: A study on β-thalassemia and hemoglobin E/β-thalassemia patients in Indonesia., Hematol Oncol Stem Cell Ther , 9(2), 55-63, 2016 PubMed
  11. Chaouch L, Moumni I, Ouragini H, Darragi I, Kalai M, Chaouachi D, Boudrigua I, Hafsia R, Abbes S, rs11886868 and rs4671393 of BCL11A associated with HbF level variation and modulate clinical events among sickle cell anemia patients., Hematology , 21(7), 425-9, 2016 PubMed
Created on 2013-06-28 11:32:13, Last reviewed on 2016-10-24 11:10:18 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.