IthaID: 2036



Names and Sequences

Functionality: Neutral polymorphism
Common Name: -487 T>C HGVS Name: NG_000007.3:g.70076C>T

Context nucleotide sequence:
ACAGAATGGATGAAAACTCTACCTC [A/G] GTTCTAAGCATATCTTCTCCTTATT (Strand: -)

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70076
Size: 1 bp
Located at: β
Specific Location: N/A

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Liu L, Muralidhar S, Singh M, Sylvan C, Kalra IS, Quinn CT, Onyekwere OC, Pace BS, High-density SNP genotyping to define beta-globin locus haplotypes., Blood Cells Mol. Dis. , 42(1), 16-24, 2009 PubMed
  2. Lam KW, Jiang P, Liao GJ, Chan KC, Leung TY, Chiu RW, Lo YM, Noninvasive prenatal diagnosis of monogenic diseases by targeted massively parallel sequencing of maternal plasma: application to β-thalassemia., Clin. Chem. , 58(10), 1467-75, 2012 PubMed
  3. Papasavva TE, Lederer CW, Traeger-Synodinos J, Mavrou A, Kanavakis E, Ioannou C, Makariou C, Kleanthous M, A minimal set of SNPs for the noninvasive prenatal diagnosis of β-thalassaemia., Ann. Hum. Genet. , 77(2), 115-24, 2013 PubMed
Created on 2013-06-27 11:18:16, Last reviewed on 2014-04-23 16:18:29 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.