IthaID: 193



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 91 CTG>C-G HGVS Name: HBB:c.275del
Hb Name: Hb Morgantown Protein Info: β 91 (-T); modified C-terminal sequence

Context nucleotide sequence:
GGCACCTTTGCCACACTGAGTGAGC [-/T] GCACTGTGACAAGCTGCACGTGGAT (Strand: -)

Comments: Hb Morgantown, causes a frame shift in the coding DNA sequence and results in a variant beta-globin chain with 156 amino acid residues before it is terminated by an in frame TAA termination codon. The amino acids from codon 91 till the carboxyl-end are entirely different from those of a normal beta-globin chain, which has 146 amino acids.

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70999
Size: 1 bp
Located at: β
Specific Location: Exon 2

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:Dominant
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Irish
Inheritance: Dominant
DNA Sequence Determined: No
Detection Methods: MLPA

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Luo HY, Tang W, Eung SH, Coad JE, Canfield P, Keller F, Crowell EH, Steinberg MH, Chui DH, Dominantly inherited beta thalassaemia intermedia caused by a new single nucleotide deletion in exon 2 of the beta globin gene: Hb morgantown (beta91 CTG>CG)., Journal of clinical pathology, 58(10), 1110-2, 2005 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2014-04-08 13:05:43 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.