IthaID: 193
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 91 CTG>C-G | HGVS Name: | HBB:c.275del |
| Hb Name: | Hb Morgantown | Protein Info: | β 91 (-T); modified C-terminal sequence |
Context nucleotide sequence:
GGCACCTTTGCCACACTGAGTGAGC [-/T] GCACTGTGACAAGCTGCACGTGGAT (Strand: -)
Also known as:
Comments: Hb Morgantown, causes a frame shift in the coding DNA sequence and results in a variant beta-globin chain with 156 amino acid residues before it is terminated by an in frame TAA termination codon. The amino acids from codon 91 till the carboxyl-end are entirely different from those of a normal beta-globin chain, which has 146 amino acids.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
| Allele Phenotype: | Dominant |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70999 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Irish |
| Molecular mechanism: | N/A |
| Inheritance: | Dominant |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Luo HY, Tang W, Eung SH, Coad JE, Canfield P, Keller F, Crowell EH, Steinberg MH, Chui DH, Dominantly inherited beta thalassaemia intermedia caused by a new single nucleotide deletion in exon 2 of the beta globin gene: Hb morgantown (beta91 CTG>CG)., Journal of clinical pathology, 58(10), 1110-2, 2005 PubMed
Created on 2010-06-16 16:13:15,
Last reviewed on 2014-04-08 13:05:43 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2010-06-16 16:13:15 | The IthaGenes Curation Team | Created |
| 2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2014-04-08 13:05:43 | The IthaGenes Curation Team | Reviewed. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07