IthaID: 185
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 82/83 (-G) | HGVS Name: | HBB:c.251delG |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
CCTGGCTCACCTGGACAACCTCAAGG [-/G] CACCTTTGCCACACTGAGTGAGCT (Strand: -)
Also known as:
Comments: Found in an Azerbaijanian patient with β0-thalassaemia [PMID: 2525253]. Found in three different alleles of unrelated patients with β-thalassaemia major from Azerbaijan [PMID: 1483699]. Found in seven members of two families of Czech decent [PMID: 1740317]. Found in a Yugoslavian family of Croatian nationality with a heterozygosity for β-thalassaemia [PMID: 1517107]. The deletion of a nt G in codons 82/83 changes the reading frame with a stop codon at codon 88 resulting in a premature termination of translation.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β0 |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70975 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Azerbaijanian, Czech, Croatian |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | No |
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Frequencies
Publications / Origin
- Schwartz EI, Gol'tsov AA, Kaboev OK, Alexeev AA, Solovyev GYa , Surin VL, Lukianenko AV, Vinogradov SV, Berlin YuA , A novel frameshift mutation causing beta-thalassaemia in Azerbaijan., Nucleic acids research, 17(10), 3997, 1989 PubMed
- Indrak K, Brabec V, Indrakova J, Chrobak L, Sakalova A, Jarosova M, Cermak J, Fei YJ, Kutlar F, Gu YC, Molecular characterization of beta-thalassemia in Czechoslovakia., Human genetics, 88(4), 399-404, 1992 PubMed
- Cürük MA, Yüregir GT, Asadov CD, Dadasova T, Gu LH, Baysal E, Gu YC, Ribeiro ML, Huisman TH, Molecular characterization of beta-thalassemia in Azerbaijan., Human genetics, 90(4), 417-9, 1992 PubMed
- Jankovic L, Dimovski AJ, Efremov GD, Juricic D, A mutation of CDS 82/83 (-G) observed in a Yugoslavian family with a heterozygosity for beta-thalassemia., Hemoglobin, 16(4), 291-4, 1992 PubMed
Created on 2010-06-16 16:13:15,
Last reviewed on 2019-11-08 14:51:47 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2010-06-16 16:13:15 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
3 | 2019-11-08 14:51:47 | The IthaGenes Curation Team | Reviewed. HGVS name, Context sequence, Location and dbSNP link corrected. Comment and Referenced added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2021-02-26 08:21:52