IthaID: 177



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 71/72 (+A) HGVS Name: HBB:c.217dupA
Hb Name: N/A Protein Info: β 72(+A); modified C-terminal sequence: (72)Lys-COOH

Context nucleotide sequence:
GGCAAGAAAGTGCTCGGTGCCTTT [-/A] AGTGATGGCCTGGCTCACCTGG (Strand: -)

Also known as:

Comments: The introduction of a nt A between codons 71 and 72 (TTTAGT>TTTAAGT) results in a frameshift with a nonsense codon at codon 73 (TGA) and premature termination of translation.

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70941
Size: 1 bp
Located at: β
Specific Location: Exon 2

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Chinese
Inheritance: Recessive
DNA Sequence Determined: No

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Cheng TC, Orkin SH, Antonarakis SE, Potter MJ, Sexton JP, Markham AF, Giardina PJ, Li A, Kazazian HH, beta-Thalassemia in Chinese: use of in vivo RNA analysis and oligonucleotide hybridization in systematic characterization of molecular defects., Proceedings of the National Academy of Sciences of the United States of America, 81(9), 2821-5, 1984 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2019-11-12 16:26:35 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.