IthaID: 177
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 71/72 (+A) | HGVS Name: | HBB:c.217dupA |
| Hb Name: | N/A | Protein Info: | β 72(+A); modified C-terminal sequence: (72)Lys-COOH |
Context nucleotide sequence:
GGCAAGAAAGTGCTCGGTGCCTTT [-/A] AGTGATGGCCTGGCTCACCTGG (Strand: -)
Also known as:
Comments: The introduction of a nt A between codons 71 and 72 (TTTAGT>TTTAAGT) results in a frameshift with a nonsense codon at codon 73 (TGA) and premature termination of translation.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70941 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Frequencies
Publications / Origin
- Cheng TC, Orkin SH, Antonarakis SE, Potter MJ, Sexton JP, Markham AF, Giardina PJ, Li A, Kazazian HH, beta-Thalassemia in Chinese: use of in vivo RNA analysis and oligonucleotide hybridization in systematic characterization of molecular defects., Proceedings of the National Academy of Sciences of the United States of America, 81(9), 2821-5, 1984 PubMed
Created on 2010-06-16 16:13:15,
Last reviewed on 2019-11-12 16:26:35 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2010-06-16 16:13:15 | The IthaGenes Curation Team | Created |
| 2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2014-06-04 12:39:03 | The IthaGenes Curation Team | Reviewed. HbVar link added. |
| 4 | 2019-11-12 09:53:05 | The IthaGenes Curation Team | Reviewed. Common name, HGVS name and Location corrected. Allele, Context sequence and Comment added. |
| 5 | 2019-11-12 16:26:35 | The IthaGenes Curation Team | Reviewed. Commont name corrected. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07