IthaID: 171



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 62-64 (-7bp) HGVS Name: HBB:c.189_195delTCATGGC
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GGGCAACCCTAAGGTGAAGGC [TCATGGC/-] AAGAAAGTGCTCGGTGCCTTT (Strand: -)

Comments: The 7bp deletion caused a shift in the normal reading frame of the β-globin coding sequence and created a stop codon at codon 87. This led to an altered β chain with only 23 residues and to a β0 thalassaemia phenotype.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70913
Size: 7 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Italian, Chinese
Molecular mechanism: Altered heme pocket
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. He S, Lin L, Wei Y, Chen B, Yi S, Chen Q, Qiu X, Wei H, Li G, Zheng C, Identification of a Novel β-Globin Mutation (HBB: C.189_195delTCATGGC) in a Chinese Family., Hemoglobin , 40(4), 277-9, 2016 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2021-10-20 16:00:20 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.