IthaID: 163
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 54/55 (+A) | HGVS Name: | HBB:c.166dupA |
Hb Name: | N/A | Protein Info: | β 55(+A); modified C-terminal sequence: (55)Asn-Gly-Gln-(58)Pro-COOH |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GGATCTGTCCACTCCTGATGCTGTT [-/A] ATGGGCAACCCTAAGGTGAAGGCTC (Strand: -)
Comments: Found in a heterozygous state in one individual from Maharashtra, Bombay region, during caste screening. The introduction of a nt A between codons 54 and 55 (GTTATG>GTTAATG) results in a frameshift with a nonsense codon at codon 59 (TAA) and premature termination of translation.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β0 |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70890 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Insertion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Asian Indian |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Garewal G, Fearon CW, Warren TC, Marwaha N, Marwaha RK, Mahadik C, Kazazian HH, The molecular basis of beta thalassaemia in Punjabi and Maharashtran Indians includes a multilocus aetiology involving triplicated alpha-globin loci., British journal of haematology, 86(2), 372-6, 1994 PubMed
Created on 2010-06-16 16:13:15,
Last reviewed on 2019-11-12 16:25:24 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.