IthaID: 1574



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: -114 to -102 HGVS Name: HBG1:c.-167_-155delCAATAGCCTTGAC
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
ATGGGTTGGCCAGCCTTGCCTTGAC [-/CAATAGCC] AAGGCAAACTTGACCAATAGTCTTA (Strand: -)

Also known as: 13 bp deletion , Black non-deletional HPFH

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: HPFH
Hemoglobinopathy Subgroup: HPFH
Allele Phenotype:HPFH
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 47645
Size: 1 bp
Located at:
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: African
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Gilman JG, Mishima N, Wen XJ, Stoming TA, Lobel J, Huisman TH, Distal CCAAT box deletion in the A gamma globin gene of two black adolescents with elevated fetal A gamma globin., Nucleic acids research, 16(22), 10635-42, 1988 PubMed
Created on 2010-06-16 16:13:17, Last reviewed on 2013-10-15 17:28:32 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.