IthaID: 1573

Context nucleotide sequence:
CCCATGGGTTGGCCAGCCTTGCCTT [A/G] ACCAATAGCCTTGACAAGGCAAACT (Strand: -)

Also known as: Greek/Italian/Black non-deletional HPFH

Comments: HPFH mutation, 7-33% of HbF in individuals carrying beta-thalassaemia mutations. Possibly disrupts binding site (TGACCA) of BCL11A transcriptional repressor.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Heterozygous records (preview in IthaPhen)

1. Collins FS, Metherall JE, Yamakawa M, Pan J, Weissman SM, Forget BG, A point mutation in the A gamma-globin gene promoter in Greek hereditary persistence of fetal haemoglobin., Nature, 313(6000), 325-6, 1985 PubMed
2. Gelinas R, Endlich B, Pfeiffer C, Yagi M, Stamatoyannopoulos G, G to A substitution in the distal CCAAT box of the A gamma-globin gene in Greek hereditary persistence of fetal haemoglobin., Nature, 313(6000), 323-5, 1985 PubMed
3. Huang HJ, Stoming TA, Harris HF, Kutlar F, Huisman TH, The Greek A gamma beta+-HPFH observed in a large black family., American journal of hematology, 25(4), 401-8, 1987 PubMed
4. Ottolenghi S, Camaschella C, Comi P, Giglioni B, Longinotti M, Oggiano L, Dore F, Sciarratta G, Ivaldi G, Saglio G, A frequent A gamma-hereditary persistence of fetal hemoglobin in northern Sardinia: its molecular basis and hematologic phenotype in heterozygotes and compound heterozygotes with beta-thalassemia., Human genetics, 79(1), 13-7, 1988 PubMed
5. Weber L, Frati G, Felix T, Hardouin G, Casini A, Wollenschlaeger C, Meneghini V, Masson C, De Cian A, Chalumeau A, Mavilio F, Amendola M, Andre-Schmutz I, Cereseto A, El Nemer W, Concordet JP, Giovannangeli C, Cavazzana M, Miccio A, Editing a γ-globin repressor binding site restores fetal hemoglobin synthesis and corrects the sickle cell disease phenotype., Sci Adv . , 6(7), 0, 2020 PubMed