IthaID: 1571
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | -175 T>C | HGVS Name: | HBG1:c.-228T>C |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
CTTCCCCACACTATCTCAATGCAAA [C/T] ATCTGTCTGAAACGGTCCCTGGCTA (Strand: -)
Also known as: Black non-deletional HPFH
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | HPFH |
|---|---|
| Hemoglobinopathy Subgroup: | HPFH |
| Allele Phenotype: | HPFH |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 47584 |
| Size: | 1 bp |
| Located at: | Aγ |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | African |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Stoming TA, Stoming GS, Lanclos KD, Fei YJ, Altay C, Kutlar F, Huisman TH, An A gamma type of nondeletional hereditary persistence of fetal hemoglobin with a T----C mutation at position -175 to the cap site of the A gamma globin gene., Blood, 73(1), 329-33, 1989 PubMed
- Coleman MB, Adams JG, Steinberg MH, Plonczynski MW, Harrell AH, Castro O, Winter WP, G gamma A gamma (beta+) hereditary persistence of fetal hemoglobin: the G gamma -158 C-->T mutation in cis to the -175 T-->C mutation of the A gamma-globin gene results in increased G gamma-globin synthesis., American journal of hematology, 42(2), 186-90, 1993 PubMed
- Akinbami AO, Campbell AD, Han ZJ, Luo HY, Chui DH, Steinberg MH, Hereditary Persistence of Fetal Hemoglobin Caused by Single Nucleotide Promoter Mutations in Sickle Cell Trait and Hb SC Disease., Hemoglobin , 40(1), 64-5, 2016 PubMed
Created on 2010-06-16 16:13:17,
Last reviewed on 2016-08-26 09:05:02 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2010-06-16 16:13:17 | The IthaGenes Curation Team | Created |
| 2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2016-08-26 09:05:02 | The IthaGenes Curation Team | Reviewed. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-12-03 11:48:06