IthaID: 1570



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: -195 C>G HGVS Name: HBG1:c.-248C>G
Hb Name: N/A Protein Info: N/A
Also known as: Brazilian non-deletional HPFH

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CAGTATCCTCTTGGGGGCCCCTTCC [C/G] CACACTATCTCAATGCAAATATCTG (Strand: -)

Comments: HPFH mutation, 5-7% of HbF in heterozygous carriers. Disrupts binding site (CCCCTTCCCC) of LRF transcriptional repressor.

External Links

Phenotype

Hemoglobinopathy Group: HPFH
Hemoglobinopathy Subgroup: HPFH
Allele Phenotype:HPFH
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 47564
Size: 1 bp
Located at:
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Brazilian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Costa FF, Zago MA, Cheng G, Nechtman JF, Stoming TA, Huisman TH, The Brazilian type of nondeletional A gamma-fetal hemoglobin has a C----G substitution at nucleotide -195 of the A gamma-globin gene., Blood, 76(9), 1896-7, 1990 PubMed
  2. Weber L, Frati G, Felix T, Hardouin G, Casini A, Wollenschlaeger C, Meneghini V, Masson C, De Cian A, Chalumeau A, Mavilio F, Amendola M, Andre-Schmutz I, Cereseto A, El Nemer W, Concordet JP, Giovannangeli C, Cavazzana M, Miccio A, Editing a γ-globin repressor binding site restores fetal hemoglobin synthesis and corrects the sickle cell disease phenotype., Sci Adv . , 6(7), 0, 2020 PubMed
Created on 2010-06-16 16:13:17, Last reviewed on 2020-10-08 13:22:57 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.