IthaID: 1555



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: -202 C>G HGVS Name: HBG2:c.-255C>G
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
TAAGCAGCAGTATCCTCTTGGGGGC [C/G] CCTTCCCCACACTATCTCAATGCAA (Strand: -)

Also known as: Black non-deletional HPFH

Comments: HPFH mutation, 14–24% of HbF in individuals carrying HBB*S mutation. Disrupts binding site (CCCCTTCCCC) of LRF transcriptional repressor.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: HPFH
Hemoglobinopathy Subgroup: HPFH
Allele Phenotype:HPFH
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 42633
Size: 1 bp
Located at:
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: African
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Collins FS, Stoeckert CJ, Serjeant GR, Forget BG, Weissman SM, G gamma beta+ hereditary persistence of fetal hemoglobin: cosmid cloning and identification of a specific mutation 5' to the G gamma gene., Proceedings of the National Academy of Sciences of the United States of America, 81(15), 4894-8, 1984 PubMed
  2. Akinbami AO, Campbell AD, Han ZJ, Luo HY, Chui DH, Steinberg MH, Hereditary Persistence of Fetal Hemoglobin Caused by Single Nucleotide Promoter Mutations in Sickle Cell Trait and Hb SC Disease., Hemoglobin , 40(1), 64-5, 2016 PubMed
  3. Weber L, Frati G, Felix T, Hardouin G, Casini A, Wollenschlaeger C, Meneghini V, Masson C, De Cian A, Chalumeau A, Mavilio F, Amendola M, Andre-Schmutz I, Cereseto A, El Nemer W, Concordet JP, Giovannangeli C, Cavazzana M, Miccio A, Editing a γ-globin repressor binding site restores fetal hemoglobin synthesis and corrects the sickle cell disease phenotype., Sci Adv . , 6(7), 0, 2020 PubMed
Created on 2010-06-16 16:13:17, Last reviewed on 2020-10-08 13:05:50 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.