IthaID: 151



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 44 -C HGVS Name: HBB:c.135delC
Hb Name: N/A Protein Info: β 44 (-C); modified C-terminal sequence: (44)Ser-Leu-Gly-Ile-Cys-Pro-Leu-Leu-Met-Leu- Leu-Trp-Ala-Thr-Leu-(59)Arg-COOH

Context nucleotide sequence:
CTTGGACCCAGAGGTTCTTTGAGTC [-/C] TTTGGGGATCTGTCCACTCCTGATG (Strand: -)

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70859
Size: 1 bp
Located at: β
Specific Location: Exon 2

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Kurdish
Inheritance: Recessive
DNA Sequence Determined: No
Detection Methods: MLPA

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Kinniburgh AJ, Maquat LE, Schedl T, Rachmilewitz E, Ross J, mRNA-deficient beta o-thalassemia results from a single nucleotide deletion., Nucleic acids research, 10(18), 5421-7, 1982 PubMed
  2. Rund D, Cohen T, Filon D, Dowling CE, Warren TC, Barak I, Rachmilewitz E, Kazazian HH, Oppenheim A, Evolution of a genetic disease in an ethnic isolate: beta-thalassemia in the Jews of Kurdistan., Proceedings of the National Academy of Sciences of the United States of America, 88(1), 310-4, 1991 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2014-05-12 09:26:13 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.