IthaID: 147

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Pathogenic / Likely Pathogenic
Common Name:	CD 41/42 (-CTTT)	HGVS Name:	HBB:c.126_129delCTTT
Hb Name:	N/A	Protein Info:	β 41 - 42 (-TTCT) or β 41 - 42 (-CTTT) or β 41 - 42 (-TCTT); modified C-terminal sequence

Context nucleotide sequence:
TGGTCTACCCTTGGACCCAGAGGTT [-/CTTT] GAGTCCTTTGGGGATCTGTCCACTC (Strand: -)

Also known as: CD 41/42 (-TTCT), CD 41/42 (-TCTT)

Comments: Also reported in literature as CD 41/42 -TTCT or -TCTT, which do not follow the HGVS Sequence Variant Nomeclature recommendations.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

HbVar	dbSNP
OMIM	LOVD
ClinVar

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	β-thalassaemia
Allele Phenotype:	β0
Associated Phenotypes:	Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	70850
Size:	4 bp
Located at:	β
Specific Location:	Exon 2

Other details

Type of Mutation:	Point-Mutation(Deletion)
Effect on Gene/Protein Function:	Frameshift (Translation)
Ethnic Origin:	Chinese, SE Asian, Indian, Thai
Molecular mechanism:	Altered heme pocket
Inheritance:	Recessive
DNA Sequence Determined:	No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

Kimura A, Matsunaga E, Takihara Y, Nakamura T, Takagi Y, Lin S, Lee H, Structural analysis of a beta-thalassemia gene found in Taiwan., The Journal of biological chemistry, 258(5), 2748-9, 1983 PubMed
Kazazian HH, Orkin SH, Antonarakis SE, Sexton JP, Boehm CD, Goff SC, Waber PG, Molecular characterization of seven beta-thalassemia mutations in Asian Indians., The EMBO journal, 3(3), 593-6, 1984 PubMed
Panyasai S, Satthakarn S, Pornprasert S, Complex Interaction of Hb Q-Thailand (HBA1: c.223G>C) with β-Thalassemia/Hb E (HBB: c.79G>A) Disease., Hemoglobin, 42(1), 54-57, 2018 PubMed

Created on 2010-06-16 16:13:15, Last reviewed on 2021-12-15 11:47:43 (Show full history)

A/A	Date	Curator(s)	Comments
1	2010-06-16 16:13:15	The IthaGenes Curation Team	Created
2	2013-10-15 17:28:32	The IthaGenes Curation Team	Reviewed.
3	2014-04-11 09:53:09	The IthaGenes Curation Team	Reviewed. Corrected mutation size
4	2014-04-24 16:05:19	The IthaGenes Curation Team	Reviewed. Added ClinVar link.
5	2015-01-19 15:17:00	The IthaGenes Curation Team	Reviewed. Common name and HGVS name updated.
6	2015-01-19 15:18:17	The IthaGenes Curation Team	Reviewed. Protein name updated.
7	2019-09-27 12:55:17	The IthaGenes Curation Team	Reviewed. Reference, Origin and DNA info added.
8	2019-11-04 13:59:20	The IthaGenes Curation Team	Reviewed. Protein name added.
9	2019-11-21 17:04:51	The IthaGenes Curation Team	Reviewed. Common/HGVS names and Location corrected. Comment added.
10	2021-12-15 11:47:43	The IthaGenes Curation Team	Reviewed. Other names added.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.