IthaID: 1444

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	N/A
Common Name:	CD 80 GAT>TAT [Asp>Tyr]	HGVS Name:	HBG2:c.241G>T
Hb Name:	Hb F-Paulinia	Protein Info:	Gγ 80(EF4) Asp>Tyr

Context nucleotide sequence:
GGGAGATGCCATAAAGCACCTGGAT [A/G/T] ATCTCAAGGGCACCTTTGCCCAGCT (Strand: -)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

HbVar

dbSNP

Phenotype

Hemoglobinopathy Group:	Structural Haemoglobinopathy
Hemoglobinopathy Subgroup:	γ-chain variant
Allele Phenotype:	N/A
Stability:	N/A
Oxygen Affinity:	N/A
Associated Phenotypes:	N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	43250
Size:	1 bp
Located at:	Gγ
Specific Location:	Exon 2

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	Missense codons (Protein Structure)
Ethnic Origin:	Sardinian, African
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Duarte DF, Albuquerque DM, Pereira Pinheiro VR, Ferreira Costa F, De Fátima Sonati M, Three new structural variants of fetal hemoglobin: Hb F-Campinas [Agamma g121(GH4)Glu --> Gln], Hb F-Paulinia [Ggamma 80(EF4)Asp --> Tyr] and Hb F-Joanopolis [Ggamma73(E17) Asp -->Ala]., Haematologica, 88(11), 1316-7, 2003 PubMed
Mereu P, Multineddu C, Sannai M, Pirastru M, Manca L, Masala B, Two abnormal fetal hemoglobins found in the Sardinian population: the new Hb F-Osilo [(A)gamma119(GH2)Gly-->Ser, GGC > AGC] and Hb F-Paulinia [(G)gamma80(EF4)Asp-->Tyr, GAT > TAT] already described in the Brazilian population., Hemoglobin, 33(6), 480-5, 2009 PubMed

Created on 2010-06-16 16:13:17, Last reviewed on 2014-04-09 09:21:59 (Show full history)

A/A	Date	Curator(s)	Comments
1	2010-06-16 16:13:17	The IthaGenes Curation Team	Created
2	2013-10-15 17:00:14	The IthaGenes Curation Team	Reviewed.
3	2014-04-09 09:21:59	The IthaGenes Curation Team	Reviewed.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.