IthaID: 141



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 38/39 (-CC) HGVS Name: HBB:c.117_118delCC
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
AGGCTGCTGGTGGTCTACCCTTGGAC [-/CC] AGAGGTTCTTTGAGTCCTTTGGGG (Strand: -)

Comments: Deletion of the two nt CC generates a frameshift and a premature termination codon at codon 42 (TGA). Found as a heterozygote in members of a Belgian family.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70841
Size: 2 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Belgian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Heusterspreute M, Derclaye I, Gala JL, Van Geet C, Ferrant A, Malchaire Y, Thonnard J, Vaerman JL, Philippe M, Beta-thalassaemia in indigenous Belgian families: identification of a novel mutation., Human genetics, 98(1), 77-9, 1996 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2019-11-07 12:59:49 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.