IthaID: 1338



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 91 (+T) HGVS Name: HBD:c.275dupT
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GCACTTTTTCTCAGCTGAGTGAGC [-/T] GCACTGTGACAAGCTGCACGTGGA (Strand: -)

Also known as:

Comments: The insertion of an extra T nucleotide at codon 91, gives rise to a premature stop codon at position 94 leading to the silencing of the gene.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: δ-thalassaemia
Allele Phenotype:δ0
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 63585
Size: 1 bp
Located at: δ
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Belgian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Losekoot M, Fodde R, Giordano PC, Bernini LF, A novel delta zero-thalassemia arising from a frameshift insertion, detected by direct sequencing of enzymatically amplified DNA., Human genetics, 83(1), 75-8, 1989 PubMed
Created on 2010-06-16 16:13:17, Last reviewed on 2021-12-03 12:42:24 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.