IthaID: 1324
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | -68 (C>T) | HGVS Name: | HBD:c.-118C>T |
Hb Name: | N/A | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CCTCCCTGCTCCAGTGAGCAGGTTG [A/G] TTTAAGATAAGCAGGGTTTCATTAG (Strand: +)
Comments: SNP associated with δ-thalassaemia. SNP was found in sickle cell anaemia patients with the Saudi-Indian (SI) or Arab-Indian (AI) haplotype and high HbF levels. There is no evidence that this SNP regulates HBG expression.
External Links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | δ-thalassaemia |
Allele Phenotype: | δ+ |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 63065 |
Size: | 1 bp |
Located at: | δ |
Specific Location: | Promoter |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Dutch |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Frequencies
Publications / Origin
- Bouva MJ, Harteveld CL, van Delft P, Giordano PC, Known and new delta globin gene mutations and their diagnostic significance., Haematologica, 91(1), 129-32, 2006 PubMed
- Phylipsen M, Gallivan MV, Arkesteijn SG, Harteveld CL, Giordano PC, Occurrence of common and rare δ-globin gene defects in two multiethnic populations: thirteen new mutations and the significance of δ-globin gene defects in β-thalassemia diagnostics., Int J Lab Hematol , 33(1), 85-91, 2011 PubMed
- Habara AH, Shaikho EM, Steinberg MH, Fetal hemoglobin in sickle cell anemia: The Arab-Indian haplotype and new therapeutic agents., Am. J. Hematol. , 2017 PubMed
Created on 2010-06-16 16:13:17,
Last reviewed on 2019-07-03 09:33:08 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.