IthaID: 13
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | -86 C>G | HGVS Name: | HBB:c.-136C>G |
| Hb Name: | N/A | Protein Info: | β nt -86 C>G |
Context nucleotide sequence:
AGACCTCACCCTGTGGAGCCACACC [A/C/G] TAGGGTTGGCCAATCTACTCCCAGG (Strand: -)
Also known as:
Comments: The mutation is located at -86 within the proximal CACCC motif in the promoter of the HBB gene. This motif is an erythroid-specific binding site of EKLF, a transcription factor with critical role in erythropoiesis and regulation of haemoglobin switching.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β+ |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70459 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | Thai, Lebanese, Syrian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Frequencies
Publications / Origin
- Kazazian HH, The thalassemia syndromes: molecular basis and prenatal diagnosis in 1990., Seminars in hematology, 27(3), 209-28, 1990 PubMed
- Thein SL, Winichagoon P, Hesketh C, Best S, Fucharoen S, Wasi P, Weatherall DJ, The molecular basis of beta-thalassemia in Thailand: application to prenatal diagnosis., American journal of human genetics, 47(3), 369-75, 1990 PubMed
- Moassas F, Alabloog A, Murad H, Description of a Rare β-Globin Gene Mutation: -86 (C>G) (HBB: c.-136C>G) Observed in a Syrian Family., Hemoglobin, 42(3), 203-205, 2018 PubMed
Created on 2010-06-16 16:13:14,
Last reviewed on 2019-05-09 13:09:46 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2010-06-16 16:13:14 | The IthaGenes Curation Team | Created |
| 2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2014-04-28 17:51:39 | The IthaGenes Curation Team | Reviewed. Added ClinVar link and reference. |
| 4 | 2019-05-09 13:08:50 | The IthaGenes Curation Team | Reviewed. Mutation comment, Ethnic origin and Reference added. |
| 5 | 2019-05-09 13:09:46 | The IthaGenes Curation Team | Reviewed. Comment text edited. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07