IthaID: 13



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: -86 C>G HGVS Name: HBB:c.-136C>G
Hb Name: N/A Protein Info: β nt -86 C>G
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
AGACCTCACCCTGTGGAGCCACACC [A/C/G] TAGGGTTGGCCAATCTACTCCCAGG (Strand: -)

Comments: The mutation is located at -86 within the proximal CACCC motif in the promoter of the HBB gene. This motif is an erythroid-specific binding site of EKLF, a transcription factor with critical role in erythropoiesis and regulation of haemoglobin switching.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70459
Size: 1 bp
Located at: β
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Thai, Lebanese, Syrian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Kazazian HH, The thalassemia syndromes: molecular basis and prenatal diagnosis in 1990., Seminars in hematology, 27(3), 209-28, 1990 PubMed
  2. Thein SL, Winichagoon P, Hesketh C, Best S, Fucharoen S, Wasi P, Weatherall DJ, The molecular basis of beta-thalassemia in Thailand: application to prenatal diagnosis., American journal of human genetics, 47(3), 369-75, 1990 PubMed
  3. Moassas F, Alabloog A, Murad H, Description of a Rare β-Globin Gene Mutation: -86 (C>G) (HBB: c.-136C>G) Observed in a Syrian Family., Hemoglobin, 42(3), 203-205, 2018 PubMed
Created on 2010-06-16 16:13:14, Last reviewed on 2019-05-09 13:09:46 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.